Extract
Note: Please read the complete
full text with Figures and Tables at
Introduction
Chronic hepatitis B virus (HBV) infection plays a major
causative role in the development of hepatocellular
carcinoma (HCC)[1,2]. In China, HCC is the second most common
fatal cancer. HBV, which belongs to the hepadnaviridae
family, causes both acute and chronic infection of the liver.
The HBV genome consists of a circular, partially
double-stranded DNA molecule of 3.2 kb, which contains 4 genes
named S, C, P, and X genes. The HBV X (HBx) gene is the
smallest one with a length of 465 base pairs encoding a 154
amino acid protein with a molecular weight of 17 kDa,
which plays a crucial role in the development of
HCC[2]. The HBx gene was initially identified as a viral transcriptional
transactivator, which can interact with a wide variety of viral
and cellular regulatory elements, such as nuclear
transcription factors and basal transcriptional machinery of host RNA
polymerases[1,3]. During the course of HBV infection, the
integration of the HBV genome into the host genome occurs
frequently[3]; mutations of HBV DNA are found in the
integration. These mutations may reflect the function of the
virus to adjust itself to the host immunity, which may cause
the virus to inhibit the host for a long time after infection,
and may precede the development of HCC. Several studies
of HBx mutations in patients with liver diseases have been
reported previously. Point mutation in the HBx gene,
especially the double substitution (nt1762 A-T, nt1764 G-A),
leading to Lys-Met130 and Val-Ile131, occurs more frequently in
patients with liver cirrhosis and/or HCC than in patients with
chronic hepatitis B[4]. An insert mutation at nt204 (insert
AGGCCC) accompanied with nt260 (G→A) and nt264
(G/C/T→A) was detected most frequently in tissues and sera
samples from HCC patients[5]. There are also some reports
of deletion mutation of the HBx gene from the tumor tissues
of HCC, which may lead to the expression of the COOH
terminal-truncated HBx protein[6]. However, the reported
biological impacts of the mutant HBx protein are conflicting.
This may be related to the different cell lines used in the
experiments and/or the different mutant patterns of the HBx
gene.
In the present study, we identified a natural similar
mutant of the HBx gene from the sera of Chinese patients with
HBV infection by sequencing, as well as tissues of Chinese
patients with liver cancer, followed by an investigation of
the biological functions of the mutant. We found that the
mutant of the HBx protein failed to induce apoptosis, but
promoted more cell growth compared with the
wild-type HBx protein.
Materials and methods
Patient samples The samples of sera were taken from
188 cases of patients with liver diseases, including 42 chronic
hepatitis B patients, 94 liver cirrhosis patients, and 52 HCC
patients (137 males and 51 females aged 18~81 years, with an
average age of 47). The samples were obtained from Tianjin
Third Central Hospital, Tianjin, China. All patients had a
record of HBV markers according to hospital data. We
previously examined the HBV x antigen (HBxAg) and antibody to
HBxAg in the sera of this group
patients[7]. Samples of liver tumor tissues were taken from 48 cases of patients with HCC
from Tianjin First Central Hospital, Tianjin, China (43 males
and 5 females aged 21_70 years, with an average age of 51.9).
All had undergone total or subtotal hepatectomies. All of
the tumor tissue samples were frozen immediately after
surgical resection and stored in liquid nitrogen. All of the
patients had a history of HBV infection according to the
hospital data.
DNA extraction from sera and PCR
An equal volume (20 µL) of serum and DNA extract solution (Zhongshan Da'an
Gene, Guangzhou, China) were mixed together and boiled for
10 min, followed by stilled at 4 °C for 12 h, and then
centrifuged at 10 000 r/min for 5 min; 5 µL supernatant was used
for the PCR reaction. We used a nested PCR
program[8] to amplify the HBx gene from the sera of patients. The outer
primers used were 5' GTTTGCTGACGCA ACCCCC3' (nt1182_nt1200) and 5' CAATGTCCATGCCCC AAAGC3'
(nt1891_ nt1910), and the inner primers were 5'
GATCCATACTGCGGAACT CC3' (nt1263_nt1282) and 5'
AGCTTGGAGGCTTGAACAGT3' (nt1859_nt1878). The PCR products were corroborated by 1.5% agarose gel
electrophoresis with ethidium bromide. Then the purified PCR
products were cloned into the vector pMD18-T (TAKARA,
Dalian, China) and sequenced by Sunbio Bio-Technical
(Beijing, China).
DNA extraction from HCC tissues and
Alu_PCR To identify the integrated HBx gene in HCC tissues, an
HBx-Alu-PCR approach were used[9]. DNA was extracted from
HCC tissues by proteinase K digestion followed by
phenol/chloroform extraction, as previously
described[10]. A PCR-based technique (Alu_PCR) was employed by using
specific primers for a human Alu sequence and the HBx sequence
to effectively detect the HBX_host junction, as described
previously[11,12]. The first 10 cycles of amplification were
undertaken in a thermal cycler in a final volume of 50 µL
containing 100 ng genomic DNA as a template, 10 pmol/L
Alu primer, 100 pmol/L HBx primer, and 2.6 U
Taq DNA-Two DNA polymerase mixed with an
ExpandTM High Fidelity assay kit (Roche, Mannheim, Germany). The reaction was
carried out as a ``hot start'' PCR using the
Taq start antibody (Clontech, Palo Alto, CA, USA). The cycling
conditions consisted of denaturation for 30 s at 94 °C, annealing
for 30 s at 59 °C, and extension for 3 min at 70 °C, with an
initial denaturation period of 1 min at 94 °C. One unit of
uracil DNA glycosylase (GIBCO/BRL, Paisley, UK) was
then added to each of the tubes, and the tubes were
incubated for 30 min at 37 °C. After heating for 10 min at 94
°C to break the DNA strands at the apurinic dUTP sites, 10
pmol/L of each primer was added for the next amplification.
The "touchdown" PCR technique was employed for this
amplification[13]. Denaturation was carried out at 94 °C for
30 s and extension at 70 °C for 3 min. The annealing step
was started at 65 °C for 30 s; the temperature was then
reduced by 1 °C every second cycle until a temperature of
55 °C was reached, at which point 20 cycles had been
carried out. The final extension was carried out for 8 min at
72 °C. Thus, a total of 40 cycles were made, and 1 mL of
the product was subjected to hemi-nested PCR with the
initial primers to obtain discrete bands. Amplified PCR
products were analyzed by electrophoresis on 1% agarose
gel. Then the purified PCR products were cloned into the
pMD18-T vector (TAKARA, Dalian, China), and the
positive clones were sequenced by Sunbio
Bio-Technical (Beijing, China).
Plasmid construction To construct the eukaryotic
expression vector of the mutant HBx gene, the pMD18-T
plasmids cloning the mutant HBx gene from 3 sera of patients
were digested by EcoRI and XhoI, and the mutant HBx gene
fragment was ligated into the pcDNA3 vector, respectively.
The mutant HBx gene from patient 8-27-2 was
successfully cloned into the pcDNA3 vector, termed
pcDNA3-X-Sera, followed by confirmation of sequencing. The
fragment of the HBx gene that expresses the protein truncated
27 amino acids at the COOH terminal was generated by
PCR using the pCMV-X plasmid as a template. The primers,
including 5'-CAGAATTCATGGCTGCTAGGCTGTGC-3' and 5'-TACTCGAGAATCTCCTCCCCCAACT-3', were used.
The PCR products were subcloned into the pcDNA3 vector,
termed pcDNA3-XΔ127, followed by the confirmation of
sequencing.
Cells culture and transfection The human liver cell line
L-O2 (Nanjing KeyGen Biotech, Nanjing, China), originating
from normal human liver tissues that had been immortalized
by the stable transfection of human telomerase reverse
transcriptase (hTERT) gene, had been previously
used[14_17]. The L-O2 cells were cultured in RPMI-1640 medium (GIBCO,
Carlsbad, California, USA) supplemented with 10%
heat-inactivated fetal calf serum and penicillin (100 U/mL) and
streptomycin (100 mg/mL) in a 5% CO2 atmosphere at 37 °C. The
detailed procedures of transfection were followed
accordingly[14]. The L-O2 cells were transiently transfected with
2 µg plasmids, such as the pcDNA3 empty vector,
pcDNA3-X-Sera (from patient 8-27-2), pcDNA3-XΔ127, and
pCMV-X, respectively, by using Lipofectamine 2000 (Invitrogen,
Carlsbad, California, USA) according to the manufacturer's
instruction. Transfection efficiency in the cells was
monitored by cotransfection of 0.2 µg pEGFP-C2 plasmid, which
expresses the green fluorescence protein. After 48 h
transfection, flow cytometry analysis was performed to
detect apoptosis and cell cycle. Meanwhile, the expression of
the HBx protein was examined by Western blot analysis in
the transfected L-O2 cells. To construct cell lines stably
expressing the wild-type or mutant HBx gene, G418 was added
to the medium to a final concentration of 600 µg/mL after 48
h transfection. The cell lines that were stably transfected
the pCMV-X (termed L-O2-X), pcDNA3-XΔ127 (termed
L-O2-XΔ127), pcDNA3-X-Sera (termed L-O2-X-Sera), and pcDNA3 empty vector (termed L-O2-pcDNA3)
plasmids, respectively, were examined for the presence of
wild-type or mutant HBx gene in the host genome by PCR.
Flow cytometry analysis The detailed procedures were
followed accordingly[14]. The stable transfected cell lines,
including L-O2-X, L-O2-XΔ127, L-O2-X-Sera, and
L-O2-pcDNA3, were examined by a FACScan flow cytometer
(Becton, Dickinson, San Jose, CA, USA), followed by the
examination of cell proliferation. The cell proliferative index
(PI) is the sum of the S and G2/M phase activities of the cell
cycle expressed as a fraction of the total cell population, that
is, PI=([S+G2/M]/
[G0/G1+S+G2/M])×100
[14]. The experiment was repeated 3 times.
BrdU labeling and immunofluorescent staining
The detailed procedures were followed
accordingly[14]. The 5'-bromodeoxyuridine (BrdU) labeling index was assessed by
point counting through a Nikon TE200 inverted microscope
(Nikon, Tokyo, Japan) using a 40× objective lens. Propidium
iodine (Sigma, St Louis, MO USA) staining for nuclei in
50 µg/mL was used as a control to all cells in each group.
Luciferase reporter gene assays The luciferase
reporters used included pGL3-NF-κB, pGL3-hTERT, pGL3-survivin,
pGL3-basic, and renilla luciferase reporter vector pRL-TK.
For transient transfections, the L-O2 cells were collected and
plated in 24-well plates at
0.3×105 cells per well. The L-O2 cells were transiently transfected with 0.3 µg plasmids,
including the pcDNA3 empty vector, pcDNA3-XΔ127, pcDNA3-X-Sera, and pCMV-X, respectively, by using
Lipofectamine 2000 according to the manufacturer's
instruction; each group of cells was cotransfected with 0.3
µg pGL3-NF-κB, or pGL3-hTERT, or pGL3-survivin, or
pGL3-basic plasmids, respectively. Each well of cells was
cotransfected with 10 ng pRL-TK. The cells were harvested
after 24 h. The cells were lysed in 1× passive lysis buffer,
and luciferase activity was determined by using the Dual
luciferase reporter assay system (Promega, San Luis Obispo,
CA USA) on a luminometer (TD-20/20, Sunnyvale CA, USA)
according to the manufacturer's instructions. The pcDNA3
empty vector, pGL3-basic plasmid, and mock were used as
controls.
Western blot analysis For the identification of the
tumor-related proteins, the detailed procedures of the Western
blot analysis were followed in the transfected L-O2 cells
accordingly[14]. The primary antibodies were mouse
anti-c-Myc (Santa Cruz Biotechnology, Santa Cruz, CA, USA,
1:500 dilution), rabbit anti-proliferating cell nuclear antigen
(PCNA; NeoMarkers, Fremont, CA, USA, 1:1000 dilution),
rabbit anti-HBx (1:150 dilution)[24], and mouse
anti-β-actin (Sigma, USA, 1:20 000 dilution).
Statistical analysis The statistical analysis was
performed using SigmaPlot 2001 (Systat Software,
Richmond, CA, USA, http://www.systat.com). Statistical significance
was assessed by comparing mean vales (±SD) using
Student's t-test or χ2-test.
Results
Identification of a natural HBx gene mutant
The HBx genes in the sera of patients with HBV-related liver diseases
were amplified by PCR. The PCR products were analyzed by
agarose gel electrophoresis (Figure 1A). The sequences
showed that a natural mutant of HBx gene was identified in
the sera from 1 case of chronic hepatitis B and 2 cases of
liver cirrhosis. The 3 mutants from the sera were similar to
each other in sequence. In the case of patient 8-27-2, a
fragment deletion at nt382_400 of the x gene (codons 128_133
amino acids) was found. In other 2 cases (patients 8-30-15
and 9-6-8), a fragment deletion at nt382-401 of the x gene was
observed. Figure 1B shows the matched sequences that
demonstrate a new stop codon TAG formation observed in
the downstream of each mutant after the fragment deletion.
The clinical examination of HBV in the sera from the 3
patients is shown in Table[7]. The clinical examination of HBV
in 5 out of 48 cases of HCC tissues is shown in Table 2.
To amplify the HBx gene and its insertion from the
tissues of HBV-related HCC patients, a HBV_Alu_PCR
technique was performed. The HBx gene was successfully
amplified from 5 out of 48 cases of tumor tissues. Alu_PCR
products were analyzed by agarose gel electrophoresis
(Figure 1C). The sequences showed that the fragment of the
HBx gene inserted in the genome after nt382 was truncated
at the 3' end.
Truncated HBx protein at COOH terminal loses
capability of inducing apoptosis After the transient transfection,
the flow cytometry analysis showed that the wild-type HBx
protein was able to induce apoptosis (19.65%; Figure 2A,
but the mutants of the HBx protein, such as
pcDNA3-XΔ127 and pcDNA3-X-Sera, failed to induce apoptosis (Figure 2A),
suggesting that the HBx mutants lost the ability to induce
apoptosis. The expression of the HBx protein was shown in
the transfected L-O2 cells (Figure 2A).
Truncated HBx protein at COOH terminal enhances
L-O2 cell growth The stably mutant-transfected L-O2
cells or stably fragment-transfected L-O2 cells were
established, and termed L-O2-X-Sera or L-O2-XΔ127,
respectively, followed by the investigation of the effect of
the HBx mutants on the proliferation of the L-O2 cells by
flow cytometry analysis and BrdU incorporation analysis.
The results showed that the percentage of cells both in S
phase and in G2/M phase significantly increased in both
L-O2-XΔ127 cells and L-O2-X-Sera cells than the controls,
suggesting that the overexpression of the truncated HBx
protein at the COOH terminal led to significantly increased
cell proliferation according to the PI (P<0.01
vs control or L-O2-X, χ2-test; Figure 2B). The BrdU incorporation
analysis showed that the induction of DNA synthesis by the
truncated HBx gene was increased in L-O2-XΔ127 and
L-O2-X-Sera cells (P<0.05 vs control or L-O2-X; Student's
t-test; Figure 2C, 2D), suggesting that the HBx mutant
enhanced L-O2 cell proliferation.
Truncated HBx protein at COOH terminal upregulates
transcriptional activity of NF-κB, survivin, and hTERT
The L-O2 cells were transiently transfected with the wild-type
HBx gene, mutant HBx gene, or the empty vector, respectively. The transcription levels of
NF-κB, survivin, and hTERT were detected by the luciferase reporter gene
assay. The results indicated that both the mutant and
wild-type HBx proteins were significantly able to stimulate the
promoter transcriptional activities of NF-κB, survivin, and
hTERT in L-O2 cells compared to the controls
(P<0.01 vs control, such as mock, pcDNA3, and basic; Student's
t-test). Moreover, the mutant HBx protein was able to remarkably
increase the activities compared to the wild-type HBx
protein (P<0.01 vs pCMV-X; Student's
t-test; Figure 3).
Truncated HBx protein at COOH terminal upregulates
expression of proteins related to cell proliferation
To investigate the molecular mechanism, we examined the
regulation of proteins, such as c-Myc and PCNA by the mutant
HBx proteins. The Western blot analysis showed that the
expression of c-Myc and PCNA were upregulated by the
mutant HBx proteins and wild-type HBx protein (Figure 4A).
Moreover, the expression levels of c-Myc and PCNA were
upregulated in both L-O2-X-Sera cells and L-O2-XΔ127 cells
than that in L-O2-X cells. We further confirmed this finding
by applying Glyco BandScan software (PROZYME, San Leandro, CA, USA; Figure 4B).
Discussion
Previous studies showed that the mutation of the HBx
gene plays a crucial role in the development of HBV-related
HCC. In the present study, we found that the HBx gene
showed heterogeneity, and both the wild-type and mutant
HBx gene could be detected in the tumor tissues. HBx
mutants, especially the integrated HBx gene, displayed the
loss of different size of fragments at the carboxyl
terminal[3,18]. Reports on HBx mutation vary depending on different
geographic regions. It has been reported that nt382_389 (codons
128_130 aa) in HCC samples collected from Qidong,
China[19] and nt93 (codon 31 aa) in HCC samples from
Taiwan[20] of the HBx gene were found, which were the hot spots
of mutation. Recently, Xu et al reported that human APOBEC3
(apolipoprotein B mRNA editing enzyme, catalytic
polypeptide 3) led to G-to-A mutation at positions 359 and 360 (TGG
to TAA, TAG, or TGA) which generated a premature stop
codon at position 120 amino acid in the HBx gene, resulting
in the synthesis of a truncated HBx protein missing the last
35 amino acids. It caused a gain of function that enhanced
the colony-forming ability and proliferative capacity of
neoplastic cells[21].
In our present study, we found a natural HBx mutant
from the sera (Figure 1A,1B) and HCC tissues (Figure 1C) of
patients. According to the reports, 3 regions of the HBx
protein, such as amino acids 46_52, 61_69, and 132_139, may
be essential for the transactivation function of the HBx
protein[22]. Here, we found that the mutant with deletion
(128_154 amino acids) of the HBx protein exactly includes the
regions of amino acids 132_139. It was also reported that the
N terminal (amino acids 1_50) was important for
transformation[23]. Here, we found that the mutant pattern of the HBx
gene in HCC tissues was consistent with the ones in the
sera, suggesting that the natural mutant of the HBx
protein-truncated 27 amino acids at the COOH terminal may involve
the development of HCC. According to the clinical
examination of HBV antigens and antibodies to HBV antigens (Tables
1,2), 7 out of 8 patients with the HBx mutants were male, and
all were positive for HBsAg and antibody to hepatitis B core
antigen (anti-HBc) in the sera; 6 out 8 patients were
positive for antibody to hepatitis B e antigen (HBeAg) in the
sera. This suggests that the mutant may be related to the
active replication of HBV DNA. The clinical significance of
the HBx mutant needs to be further investigated.
In order to demonstrate the biological activities of the
mutant, we investigated the effect of the mutant on apoptosis
and cell proliferation. Our data showed that wild-type HBx
protein could remarkably induce apoptosis, but the mutant
HBx protein failed to induce apoptosis (Figure 2A). HBx has
a dual function in the stimulation of cell proliferation and
induction of apoptosis by p53-dependent mechanisms. HBx
can induce cell apoptosis in a p53-independent
manner[3]. In addition, it was reported that HBx can downregulate p21
expression by suppressing p53 expression via
protein_protein interaction[24], which might play a central role in cell
malignant transformation. The distal COOH terminal region
of HBx has been proven critical for binding to
p53[6]. Therefore, in our study, the mutant HBx protein, which lost
its capability to induce apoptosis, may be related to
HBx_p53 interaction.
A large amount of evidences shows that full-length and
the truncated HBx protein may play different roles in
HBV-related HCC development. The HBx COOH terminal
amino acids have been investigated to play a key role in regulating
its transcriptional activity and controlling cell viability and
proliferation[2]. In our experiments we found that
L-O2-X-Sera and L-O2-XΔ127 cells grew remarkably faster than
L-O2-X cells (Figure 2B_2D). Luciferase reporter gene
assay (Figure 3) provided evidences that the HBx protein
truncated at the COOH terminal is able to stimulate the
promoter transcriptional activities of NF-κB, survivin, and
hTERT in L-O2 cells, suggesting that the natural mutant has
the potential to promote cell growth through the
transcriptional activity of NF-κB, survivin, and hTERT. The
Western blot analysis revealed that c-Myc and PCNA were
upregulated by the mutant (Figure 4). Previous studies
showed that HBx can accelerate tumor development induced
by c-Myc. The coexpression of HBx and c-Myc transgenes
accelerated HCC development in transgenic mice, and the
cells with high c-Myc expression induced by HBx showed
no alteration in p53 expression[25]. In addition, another study
reported that the mutant HBx protein truncated at COOH
terminal enhanced the transforming ability of ras and
myc[2]. Therefore, we consider that the COOH terminal-truncated HBx
protein is able to enhance cell proliferation through
NF-κB and c-Myc, etc. However, the detailed molecular
mechanisms involved in the switch of HBx function in terms of
apoptosis, proliferation, and tumorigenesis need to be
clarified in further studies.
In summary, we identified a natural mutant of the HBx
gene from the sera and tissues of Chinese patients with
chronic liver diseases. Our findings provide an insight into
the roles of COOH terminal amino acids of the HBx protein in
the pathogenesis of HBV. Our data are significant, and
provide theoretical and practical value for early diagnosis,
prevention, and therapy of HCC.
References
1 Zhang X, Zhang W, Ye L. Pathogenesis of hepatitis B virus
infection. Future Virol 2006; 1: 637_47.
2 Zhang X, Zhang H, Ye L. Effects of hepatitis B virus X protein
on the development of Liver cancer. J Lab Clin Med 2006; 147:
58_66.
3 Tanaka Y, Kanai F, Kawakami T, Tateishi K, Ijichi H, Kawabe T,
et al. Interaction of the hepatitis B virus X protein (HBx) with
heat shock protein 60 enhances HBx-mediated apoptosis.
Biochem Biophys Res Commun 2004; 318: 461_9.
4 León B, Taylor L, Vargas M, Luftig RB, Albertazzi F, Herrero L,
et al. HBx M130K and V131I (T-A) mutations in HBV genotype
F during a follow-up study in chronic carriers. Virol J 2005; 2:
60_9.
5 Chen GG, Li MY, Ho RL, Chak EC, Lau WY, Lai PB.
Identification of hepatitis B virus X gene mutation in Hong Kong patients
with hepatocellular carcinoma. J Clin Virol 2005; 34: 7_12.
6 Tu H, Bonura C, Giannini C, Mouly H, Soussan P, Kew M.
et al. Biological impact of natural COOH-terminal deletions of
hepatitis B virus X protein in hepatocellular carcinoma tissues.
Cancer Res 2001; 61: 7803_10.
7 Zhang H, Wu L, Liu S, Shao X, Yang Z, Zhang X,
et al. Examination of anti-HBx in sera from patients of chronic hepatitis B,
liver cirrhosis and hepatocellular carcinoma and its clinical
significance. Chin J Lab Med 2007; 30: 292_6.
8 Minami M, Poussin K, Brechot C, Paterlini P. A novel PCR
technique using Alu-specific primers to identify unknown
flanking sequences from the human genome. Genomics 1995; 29:
403_8.
9 Sirma H, Giannini C, Poussin K, Paterlini P, Kremsdorf D, Bréchot
C. Hepatitis B virus X mutants, present in hepatocellular
carcinoma tissue abrogate both the antiproliferative and
transactivation effects of HBx. Oncogene 1999; 18: 4848_59.
10 Park SG, Lee SM, Jung G. Antisense oligodeoxynucleotides
targeted against molecular chaperonin Hsp60 block human
hepatitis B virus replication. J Biol Chem 2003; 278: 39 851_7.
11 Minami M, Poussin K, Brechot C, Paterlini P. A novel PCR
technique using Alu-specific primers to identify unknown
flanking sequences from the human genome. Genomics 1995; 29:
403_8.
12 Murakami Y, Minami M, Daimon Y, Okanoue T. Hepatitis B
virus DNA in liver, serum, and peripheral blood mononuclear
cells after the clearance of serum hepatitis B virus surface antigen.
J Med Virol 2004; 72: 203_14.
13 Don RH, Cox PT, Wainwright BJ, Baker K, Mattick JS.
`Touchdown' PCR to circumvent spurious priming during gene
amplification. Nucleic Acids Res 1991; 19: 4008.
14 Wang F, Sha L, Zhang W, Wu L, Qiao L, Li N,
et al. Involvement of hepatitis B X-interacting protein (HBXIP) in
proliferation regulation of cells. Acta Pharmacol Sin 2007; 28: 431_8.
15 Hwang GY, Lin CY, Huang LM, Wang YH, Wang JC, Hsu CT,
et al. Detection of the hepatitis B virus X protein (HBx) antigen
and anti-HBx antibodies in cases of human hepatocellular
carcinoma. J Clin Microbiol 2003; 41: 5598_603.
16 Tang NH, Chen YL, Wang XQ, Li XJ, Yin FZ, Wang XZ.
Construction of IL-2 gene-modified human hepatocyte and its
cultivation with microcarrier. World J Gastroenterol 2003; 9:
79_83.
17 Huang R, Wu T, Xu L, Liu A, Ji Y, Hu G. Upstream binding factor
up-regulated in hepatocellular carcinoma is related to the
survival and cisplatin-sensitivity of cancer cells. FASEB J 2002; 16:
293_301.
18 Liu XH, Lin J, Cao XZ, Zheng JM, Chen Y, Zhu MH. Biological
impact of the COOH-terminal 40 amino acid deletions of
hepatitis B virus X protein in hepatocellular carcinoma cells. Zhonghua
Yi Xue Za Zhi 2005; 85: 825_30.
19 Tiollais P, Pourcel C, Dejean A. The hepatitis B virus. Nature
1985; 317: 489_95.
20 Galibert F, Mandart E, Fitoussi F, Tiollais P, Charnay P.
Nucleotide sequence of the hepatitis B virus genome (subtype ayw)
cloned in E coli. Nature 1979; 281: 646_50.
21 Xu R, Zhang X, Zhang W, Fang Y, Zheng S, Yu X. Association of
human APOBEC3 cytidine deaminases with the generation of
hepatitis virus B x antigen mutants and hepatocellular carcinoma.
Hepatol 2007; 46: 1810_20.
22 Arii M, Takada S, Koike K. Identification of three essential
regions of hepatitis B virus X protein for trans-activation function.
Oncogene 1992; 7: 397_403.
23 Seeger C, Mason WS. Hepatitis B virus biology. Microbiol Mol
Biol Rev 2000; 64: 51_68.
24 Chen GG, Li MY, Ho RL, Chak EC, Lau WY, Lai PB.
Identification of hepatitis B virus X gene mutation in Hong Kong patients
with hepatocellular carcinoma. J Clin Virol 2005; 34: 7_12.
25 Yeo W, Zhong S, Chan PK, Ho WM, Wong HT, Chan AS,
et al. Sequence variations of precore/core and precore promoter
regions of hepatitis B virus in patients with or without viral
reactivation during cytotoxic chemotherapy. J Viral Hepat 2000; 7:
448_58.
|
