Extract
Note: Please read the complete
full text with Figures and Tables at
Introduction
Doxazosin is a long-acting α-1-adrenoceptor antagonist
structurally related to prazosin and terazosin. Its
antihypertensive effect is produced by a reduction in the smooth
muscle tone of peripheral vascular beds resulting in a
decrease in total peripheral resistance without significant
effect on cardiac output or heart rate. In most comparative
trials, doxazosin has proven to be equally effective as the
comparator drug in the treatment of mild to moderate
hypertension[1]. Doxazosin has a beneficial effect on some of the
risk factors associated with hypertension, including elevated
serum lipid levels, impaired glucose metabolism, insulin
resistance, and left ventricular hypertrophy. Modest
decreases in total cholesterol, low density lipoprotein
cholesterol, and triglycerides are seen with doxazosin therapy,
while small increases in high density lipoprotein cholesterol
and a high density lipoprotein cholesterol/total cholesterol
ratio are consistently reported[2].
Furthermore, in benign prostatic hyperplasia, the effect of doxazosin in relieving
bladder outflow obstruction is produced through a reduction in
prostatic tone mediated via a-1-adrenoceptor
blockade[3].
Recently, a large number of studies have demonstrated
the potential antitumor action of doxazosin. A clinical
research study reported that exposure to doxazosin
significantly decreased the incidence of prostate
cancer[4]. Doxazosin suppress prostate cancer cell growth by
inducing apoptosis, and the apoptotic effect of doxazosin appears
to be independent of the a-1-adrenoceptor
block[5_8]. Keledjian et al demonstrated that doxazosin induced
anoikis and inhibits prostate cancer cell invasion, an effect
that was antagonized by Bcl-2[9]. Partin et al found that doxazosin mediated prostate cancer apoptosis by initially
inducing the expression of transforming growth
factor-b1 signaling effectors and subsequently
IkBa[10]. Some reports showed that doxazosin increased the activities of caspase-3
and caspase-8 in prostate cancer cells, which suggests that
doxazosin induces apoptosis of prostate cancer cells by
activating caspase-3 and caspase-8. Some research results
implicated Fas-mediated apoptosis as the underlying
mechanism of the effect of doxazosin in prostate
cells[11,12]. Shaw et al demonstrated that the ability of doxazosin to induce
apoptosis in PC-3 prostate cancer cells was in part
attributable to the inhibition of protein kinase B/Akt
activation[13]. Arencibia et al proposed a novel mechanism of action for doxazosin in prostate cancer cells that implied DNA
damage-mediated apoptosis by the downregulation
of XRCC5 and PRKDC genes[14].
Furthermore, doxazosin inhibits pituitary tumor cell
growth in vitro and in vivo by mechanisms that are in part
independent of its a-1-adrenergic receptor-blocking
actions and are involved in the downregulation of
NF-kB signaling[15].
All of the research reports discussed earlier showed that
doxazosin plays antitumor roles by inducing tumor cell
apoptosis, especially in prostate cancer. However, it has
not been mentioned whether doxazosin has the same
pro-apoptotic roles in cervical cancer cells as in prostate cancer
cells. Cervical cancer is the most common gynecological
malignant disorder worldwide. There are approximately 500
million cases of genital warts per annum worldwide and
approximately 450 000 cases of cervical cancer. It has been
estimated that approximately 420 of the 1400 women
diagnosed with cervical cancer will die within 5 years of the
diagnosis[16], so it is crucial to find efficacious therapeutic drugs
against cervical cancer.
Activator protein-2a (AP-2α) is a
sequence-specific, DNA-binding transcription factor that is a member of the
AP-2 family. AP-2 family proteins, consisting of the 5
homologous 52 kDa polypeptides of AP-2α, b, g, d, and
e, function in differentiation and
development[17_19]. Much interest has recently been focused on findings that alterations in
AP-2 activities are also related to the development of
malignancies in humans, including breast
cancer[20,21], ovarian
carcinoma[22], lung
carcinoma[23],
gliomas[24], testicular
carcinoma[25], and
melanoma[26]. The present study was initiated
to examine the effects of doxazosin on apoptosis in the
cervical cancer cell line HeLa cells, then to explore the
association of transcription factor AP-2α with doxazosin-induced
apoptosis. We demonstrated that doxazosin induced
apoptosis in HeLa cells, and transcription factor
AP-2α play roles in doxazosin-induced apoptosis. We also showed that
the caspase-3 pathway seemed to participate in
doxazosin-induced apoptosis through AP-2α.
Materials and methods
Construction of vectors, synthesis of
oligonucleotides, and drugs The expression vectors
pCMV-Myc_AP-2α were constructed by ligating the full-length cDNA of
AP-2α into the pCMV-Myc vector (Clontech, USA). To knock down the
transcription of AP-2α, the phosphorothioate antisense
oligonucleotide against AP-2α (ODNAP-2α) and the control
sense oligonucleotide (COAP-2α) were synthesized
according to published data[27]. The sequence of
ODNAP-2α was CGTCAATTTCCAAAGCATTTTCATGGATCGG, and of
COAP-2α was CAAAGTCTTGCATTATTCGGTCATAAT GGCC. Doxazosin mesylate was purchased from Sigma (St
Louis, MO, USA).
Cell culture and transient transfections The HeLa cells were cultured in 10% fetal calf serum/Dulbecco's modified
Eagle's medium (Gibco, USA) supplemented with penicillin
and streptomycin in a humidified atmosphere at 37 oC and 5% CO2, and were transfected at 80% confluence using
Lipofectamine 2000 (Invitrogen, USA) according to the
manufacturer's instructions.
RNA extraction and relative quantitative real-time
RT_PCR Total RNA was extracted from the HeLa cells using
TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. For RT_PCR, 2
µg of total RNA was subjected to a reverse transcription step using Promega
reagents (USA). Real-time PCR quantification was then
performed using a SYBR green PCR master mix (Invitrogen, USA)
with a 7900 HT fast real-time PCR system (AB, USA). For
each sample, the mRNA levels of the target genes were
corrected for the b-actin mRNA levels. The PCR primers were
5'-GCTGGGCACTGTAGGTCAATC-3' (AP-2α sense) and 5'-TTCAGGCTGTAGGGGTCGTT-3'
(AP-2α antisense), 5'-GCTCTGGTTTTCGGTGGGT-3' (caspase-3 sense) and
5'-GAGTCCATTGATTCGCTTCCA-3' (caspase-3 antisense),
and 5'-GGCGGCAACACCATGT-ACCCT-3' (b-actin sense) and
5'-AGGGGCCGGACTCGTCATACT-3' (b-actin antisense).
Western blot analysis The HeLa cells were lysed in RIPA
buffer with protease inhibitors. The protein concentration
was determined using the Bradford method with a Bio-Rad
protein assay reagent. Fifty micrograms of proteins were
subjected to electrophoresis on 12% SDS_PAGE and were
then immunoblotted with an AP-2α (3B5) monoclonal
antibody (Santa Cruz, Santa Cruz, CA, USA) and caspase-3
polyclonal antibodies (Santa Cruz, USA). Immunodetection
was performed with an enhanced chemiluminescence (ECL)
detection kit (GE Healthcare, UK).
DNA fragmentation assay DNA ladder formation was
detected by gel electrophoresis. In brief,
5×107 HeLa cells were incubated in 0.5 mL TBE buffer containing 0.25% Nonidet
and 0.1 mg/mL RNase A at 37 oC for 30 min and for an
additional 30 min with proteinase K (1 mg/mL). DNA samples
(equivalent to 1×106 cells) were electrophoresed at 100 V in
1.5% horizontal agarose gels and visualized under UV after
staining with ethidium bromide (0.5 µg/mL).
Hoechst 33258 staining Apoptotic morphological
changes in the nuclear chromatin of cells were detected by
Hoechst 33258 staining. HeLa cells seeded on sterile cover
glasses were washed with phosphate-buffered saline (PBS)
and fixed with 4% paraformaldehyde for 10 min and then
incubated with 50 µmol/L Hoechst 33258 staining solution
for 10 min. After 3 washes with PBS, the cells were viewed
under a fluorescence microscope (Zeiss Axioskop 2,
Germany).
Flow cytometric assessment of apoptosis Apoptotic and
total dead cells were determined by the Annexin
V_fluorescein-isothiocyanate (FITC)/propidium iodide (PI) detection
kit (Jingmei Biotech, China). In brief, the cultured HeLa
cells (1×105 cells) were washed with 1× Annexin V
binding buffer and stained with Annexin V (5
µL) and PI (10 µL) for 15 min at room temperature in the dark. After the
addition of 400 µL binding buffer, the cells were analyzed by
flow cytometry (Becton Dickinson FACSCalibur, USA).
Caspase-3 activity assay The activity of caspase-3 was
determined using the caspase-3 activity kit (Beyotime
Institute of Biotechnology, China). To evaluate the activity of
caspase-3, cell lysates were prepared after their respective
treatment with various designated treatments. Assays were
performed on 96-well microtitre plates by incubating 10
µL protein of cell lysate per sample in 80
µL reaction buffer (1% NP-40, 20 mmol/L Tris-HCl [pH 7.5], 137 mmol/L NaCl, and
10% glycerol) containing 10 µL caspase-3 substrate (2
mmol/L Ac-DEVD-pNA). The lysates were incubated at 37 oC for 4 h. The samples were measured with an ELISA reader at an
absorbance of 405 nm. The detailed analysis procedure was
according to the manufacturer's protocol. All the
experiments were carried out in triplicate.
Statistic analysis Statistical analysis was performed
using SPSS version 13.0 software (SPSS, Chicago, IL, USA).
Data are presented as mean±SD. Differences were analyzed
by ANOVA. Statistical significance differences were
considered when P<0.05 or P<0.01.
Results
Doxazosin induces apoptosis in HeLa cells in a
dose-dependent manner To explore the effects of
doxazosin on HeLa cell apoptosis, we tested apoptosis by the DNA ladder
formation assay, Hoechst 33258 staining, and Annexin
V_FITC/PI methods. After the HeLa cells were exposed to
various dose of doxazosin for 16 h, DNA laddering was observed,
especially when exposed to 60 µmol/L doxazosin, indicating
the occurrence of apoptosis at these concentrations (Figure
1A). Furthermore, as shown in Figure 1B, the cells treated
with 10-60 µmol/L doxazosin for 16 h showed nuclear
morphological changes typical of apoptosis with Hoechst 33258
staining, that is, nuclei fragmentation with condensed
chromatin, while almost no apoptotic nuclei were observed
in the untreated cells; the majority of cells had uniformly
stained nuclei. Figure 1C shows that when exposed to 0~60
µmol/L doxazosin for 16 h, the proportion of apoptosis cells
increased from 4.39% to 14.25%, and the total cell death
increased from 8.41% to 21.2%, as determined by the flow
cytometric analysis with Annexin V_FITC/PI double staining.
These results of the 3 assays provide substantial evidence
that doxazosin induces HeLa cell apoptosis in a
dose-dependent manner.
AP-2α participates in doxazosin-induced apoptosis in
HeLa cells To detect whether the pro-apoptotic effects of
doxazosin are associated with AP-2α, the transfections with
AP-2α overexpression constructs and the AP-2α
antisense oligonucleotide were performed respectively, then the
apoptotic effects were assessed by flow cytometric analysis.
As shown in Figure 2, the total cell death and apoptosis,
especially late apoptosis, were markedly increased with the
overexpression of AP-2α or knocking down of AP-2α when
treated with 60 µmol/L doxazosin, compared with the absence
of doxazosin (Figure 1C). Transfection with AP-2α resulted
in apoptosis, which increased from 18.47% to 26.82%, and
the total cell death increased from 62.05% to 71.24% with the
presence of 60 µmol/L doxazosin, compared with
transfection with the empty vectors,. However, transfection with the
AP-2α antisense oligonucleotide resulted in apoptosis, which
decreased from 19.70% to 13.70%, and the total cell death
decreased from 29.59% to 23.29%, compared with the sense
oligonucleotide. The above results suggest that
AP-2α can induce apoptosis in HeLa cells, and the antisense
AP-2α can partly block doxazosin-induced apoptosis.
Doxazosin upregulates the expression of
AP-2α in HeLa cells To further confirm that
AP-2α is associated with doxazosin-induced HeLa cell apoptosis, we detected the
effects of doxazosin on AP-2α expression. The
AP-2α mRNA and protein levels were increased by doxazosin in a
dose-dependent manner in the HeLa cells, as shown by relative
quantitative real-time RT_PCR (Figure 3A) and Western
blotting (Figure 3B), respectively. Together with the results of
apoptosis assays, this suggests that the pro-apoptotic
effect of doxazosin on HeLa cells is associated with
AP-2α.
Doxazosin affects the caspase-3 pathway through
AP-2 in HeLa cells A previous study reported that doxazosin
induces apoptosis of prostate cancer cells by activating
caspase-3[11], so we determined whether the caspase-3
pathway participates in doxazosin-induced apoptosis through
AP-2α in HeLa cells. The expression of caspase-3 was
detected. As shown in Figure 4A and 4B, the mRNA and
protein levels of caspase-3 in the HeLa cells were increased
in a dose-dependent manner when exposed to 0-60 µmol/L
doxazosin, suggesting that doxazosin upregulates the
expression of caspase-3. The effects of AP-2α on caspase-3
were detected with the presence of 60 µmol/L doxazosin,
Figure 5A shows that the overexpression of AP-2α resulted
in the concomitant increase of caspase-3 mRNA, whereas
the antisense AP-2α in part abolished the increased effect of
doxazosin on caspase-3 mRNA. The trend of protein levels
was similar to that of the mRNA levels (Figure 5B). Because
caspase-3 plays an important role during apoptosis,
generally only in its active form, we further detected the effects of
doxazosin and AP-2α on caspase-3 activity. The activity of
caspase-3, analyzed by measuring the levels of p-nitroanilide cleaved from the substrate N-Ac-DEVD-pNA, was increased
by doxazosin in a similar dose-dependent manner to that of
the mRNA and Western blotting results (Figure 4C). As
presented in Figure 5C, the HeLa cells transfected
with AP-2α demonstrated significant increases in
caspase-3 activity compared with that of the empty vector group; however, the
antisense AP-2α decreased the caspase-3 activity compared
with sense AP-2α. These results suggest that the
caspase-3 pathway was associated with doxazosin-induced apoptosis
through AP-2α.
Discussion
Despite the association of AP-2 with several human
malignancies[20_26], very little is known about the status of
AP-2 in cervical cancer cells. Here we investigated the
effects of a-1-adrenoceptor antagonist doxazosin on
AP-2α mRNA and protein levels in cervical cancer cells. We
found that doxazosin upregulates the expression of
AP-2α in a dose-dependent manner. We also found that doxazosin
induces apoptosis in HeLa cells in a dose-dependent
manner by a DNA fragmentation assay, flow cytometric
assessment, and Hoechst 33258 staining. We found that
the pro-apoptotic effects of doxazosin seemed to be
associated with AP-2α. the overexpression of
AP-2α resulted in increased apoptosis, whereas apoptosis was decreased
when knocking down AP-2α. This is the first report to
demonstrate that AP-2α participates in doxazosin-induced
apoptosis in HeLa cells.
Studies have demonstrated AP-2α acts as a tumor
suppressor by inducing apoptosis in melanomas and mammary
carcinomas. Wajapeyee et al found that
AP-2α inhibits the growth of cancer cells of different types, including H460
(lung carcinoma cell line), HT180 (fibrosarcoma cell line),
HCT116 (colon cancer cell line), U2OS (osteosarcoma cell
line), and SW480 (colon cancer cell line) by inducing cell
cycle arrest and apoptosis[28]. They also found that
blocking the endogenous AP-2α by small interfering RNA in
human breast cancer cells leads to decreased
apoptosis[29], and AP-2α induces apoptosis by downregulating Bcl-2 and
utilizing a Bax/cytochrome c/Apaf1 (apoptosis protease
activation factor-1)/caspase 9-dependent mitochondrial
pathway[30]. These research reports provide evidence that
supports our results.
Caspases, a family of cysteine acid proteases, are crucial
mediators of apoptosis, and include caspases-1 to -14.
Among them, caspase-3 is a frequently activated death
protease, catalyzing the specific cleavage of many key
cellular proteins and is essential for normal brain development
and in other apoptotic scenarios in a remarkable tissue-, cell
type-, or death stimulus-specific manner. Caspase-3 is also
required for some typical hallmarks of apoptosis and is
indispensable for apoptotic chromatin condensation and DNA
fragmentation in all cell types
examined[31]. A previous study reported that doxazosin induces apoptosis of prostate
cancer cells by activating
caspase-3[11]. Our results implicated the
caspase-3 pathway as the underlying mechanism of doxazosin-induced apoptosis through
AP-2α in cervical cancer cells, as displayed in Figures 4 and 5.
The present results seem to implicate the potentially
complicated interaction between AP-2α and doxazosin.
When the HeLa cells were treated with 0-60 µmol/L
doxazosin, 60 µmol/L doxazosin induced approximately a
3-fold increase in late apoptosis from 4.39% to 14.25%
(Figure 1C), but when AP-2α was overexpressed, the
treatment of the HeLa cells with 60 µmol/L doxazosin only
resulted in a 1.3-fold increase in late apoptosis from 16.1%
to 20.91% (Figure 2). These results showed that the
overexpression of AP-2α partly inhibited
doxazosin-induced apoptosis. Similar trends were observed in the
expression and activity of caspase-3. When AP-2α was not
overexpressed, the treatment of the HeLa cells with 60
µmol/L doxazosin induced significant increases in the
expression and activity of caspase-3 (Figure 4); however, the
overexpression of AP-2α with 60 µmol/L doxazosin
induced increases in the expression and activity of caspase-3
that were non-significant (Figure 5). Here, we hypothesized
a potential mechanism in which doxazosin induces apoptosis
in HeLa cells through AP-2α. AP-2α is a transcription
factor that regulates multiple genes; our study found that there
was a complicated interaction between AP-2α and doxazosin. The appropriate concentrations of doxazosin
upregulated AP-2α in a certain range and then induced
apoptosis through the actions of the upregulated
AP-2α on caspase-3. However, when AP-2α was overexpressed, the
over-threshold of AP-2α would probably inhibit the
doxazosin-induced apoptosis in a negative feedback
mechanism. Other genes controlled by AP-2α are probably
involved in this pathway; however, these need to be further
explored in future studies.
Our results demonstrate that doxazosin induces apoptosis of cervical cancer cells, and suggest at least a
partial role for AP-2α in doxazosin-induced cervical cancer
cell apoptosis. These results provide new insights for the
use of doxazosin in the therapy of cervical cancer, and that
the use of AP-2α should be explored as a therapeutic target.
References
1 Black HR. Doxazosin as combination therapy for patients with
stage 1 and stage 2 hypertension. J Cardiovasc Pharmacol 2003;
41: 866_9.
2 Pool JL. Effects of doxazosin on serum lipids: a review of the
clinical data and molecular basis for altered lipid metabolism. Am
Heart J 1991; 121: 251_9.
3 Lowe F. a-1-Adrenoceptor blockade in the treatment of benign
prostatic hyperplasia. Prostate Cancer Prostatic Dis 1999; 2:
110_9.
4 Harris AM, Warner BW, Wilson JM, Becker A, Rowland RG,
Conner W, et al. Effect of a1-adrenoceptor antagonist exposure
on prostate cancer incidence: an observational cohort study. J
Urol 2007; 178: 2176_80.
5 Kyprianou N, Benning CM. Suppression of human prostate
cancer cell growth by a1-adrenoceptor antagonists doxazosin and
terazosin via induction of apoptosis. Cancer Res 2000; 60: 4550_5.
6 Kyprianou N, Chon J, Benning CM. Effects of
a (1)-adrenoceptor (a(1)-AR) antagonists on cell proliferation and apoptosis in the
prostate: therapeutic implications in prostatic disease. Prostate
2000; 9 (Suppl): 42_6.
7 Benning CM, Kyprianou N. Quinazoline-derived
a1-adrenoceptor antagonists induce prostate cancer cell apoptosis via an
a1-adrenoceptor-independent action. Cancer Res 2002; 62:
597_602.
8 Tahmatzopoulos A, Sheng S, Kyprianou N. Maspin sensitizes
prostate cancer cells to doxazosin-induced apoptosis. Oncogene
2005; 24: 5375_83.
9 Keledjian K, Kyprianou N. Anoikis induction by
quinazoline-based a1-adrenoceptor antagonists in prostate cancer cells:
antagonistic effect of bcl-2. J Urol 2003; 169: 1150_6.
10 Partin JV, Anglin IE, Kyprianou N. Quinazoline-based
a1-adrenoceptor antagonists induce prostate cancer cell apoptosis
via TGF-b signalling and IkBa induction. Br J Cancer 2003; 88:
1615_21.
11 Walden PD, Globina Y, Nieder A. Induction of anoikis by doxazosin
in prostate cancer cells is associated with activation of
caspase-3 and a reduction of focal adhesion kinase. Urol Res 2004; 32:
261_5.
12 Garrison JB, Kyprianou N. Doxazosin induces apoptosis of
benign and malignant prostate cells via a death receptor-mediated
pathway. Cancer Res 2006; 66: 464_72.
13 Shaw YJ, Yang YT, Garrison JB, Kyprianou N, Chen CS.
Pharmacological exploitation of the a1-adrenoreceptor antagonist
doxazosin to develop a novel class of antitumor agents that
block intracellular protein kinase B/Akt activation. J Med Chem
2004; 47: 4453_62.
14 Arencibia JM, Del Rio M, Bonnin A, Lopes R, Lemoine NR,
Lopez-Barahona M. Doxazosin induces apoptosis in LNCaP
prostate cancer cell line through DNA binding and DNA-dependent
protein kinase down-regulation. Int J Oncol 2005; 27: 1617_23.
15 Fernando MA, Heaney AP. a1-Adrenergic receptor antagonists:
novel therapy for pituitary adenomas. Mol Endocrinol 2005;
19: 3085_96.
16 Franco EL, Duarte-Franco E, Ferenczy A. Cervical cancer:
epidemiology, prevention and the role of human papillomavirus
infection. Cmaj 2001; 164: 1017_25.
17 Zhang J, Hagopian-Donaldson S, Serbedzija G, Elsemore J,
Plehn-Dujowich D, McMahon AP, et al. Neural tube, skeletal and body
wall defects in mice lacking transcription factor AP-2. Nature
1996; 381: 238_41.
18 Holzschuh J, Barrallo-Gimeno A, Ettl AK, Durr K, Knapik EW,
Driever W. Noradrenergic neurons in the zebrafish hindbrain are
induced by retinoic acid and require tfap2a for expression of the
neurotransmitter phenotype. Development 2003; 130:
5741_54.
19 Knight RD, Javidan Y, Zhang T, Nelson S, Schilling TF.
AP2-dependent signals from the ectoderm regulate craniofacial
development in the zebrafish embryo. Development 2005; 132:
3127_38.
20 Turner BC, Zhang J, Gumbs AA, Maher MG, Kaplan L, Carter
D, et al. Expression of AP-2 transcription factors in human breast
cancer correlates with the regulation of multiple growth factor
signalling pathways. Cancer Res 1998; 58: 5466_72.
21 Pellikainen J, Naukkarinen A, Ropponen K, Rummukainen J,
Kataja V, Kellokoski J, et al. Expression of HER2 and its
association with AP-2 in breast cancer. Eur J Cancer 2004; 40:
1485_95.
22 Odegaard E, Staff AC, Kaern J, Florenes VA, Kopolovic J, Trope
CG, et al. The AP-2g transcription factor is upregulated in
advanced-stage ovarian carcinoma. Gynecol Oncol 2006; 100:
462_8.
23 Khattar NH, Lele SM, Kaetzel CS. Down-regulation of the
polymeric immunoglobulin receptor in non-small cell lung carcinoma:
correlation with dysregulated expression of the transcription
factors USF and AP2. J Biomed Sci 2005; 12: 65_77.
24 Heimberger AB, McGary EC, Suki D, Ruiz M, Wang H, Fuller
GN, et al. Loss of the AP-2α transcription factor is associated with
the grade of human gliomas. Clin Cancer Res 2005; 11: 267_72.
25 Hoei-Hansen CE, Nielsen JE, Almstrup K, Sonne SB, Graem N,
Skakkebaek NE, et al. Transcription factor AP-2gamma is a
developmentally regulated marker of testicular
carcinoma in situ and germ cell tumors. Clin Cancer Res 2004; 10: 8521_30.
26 Tellez C, McCarty M, Ruiz M, Bar-Eli M. Loss of activator
protein-2a results in overexpression of protease-activated
receptor-1 and correlates with the malignant phenotype of human
melanoma. J Biol Chem 2003; 278: 46 632_42.
27 Fan WH, Karnovsky MJ. Increased MMP-2 expression in
connective tissue growth factor over-expression vascular smooth
muscle cells. J Biol Chem 2002; 277: 9800_5.
28 Wajapeyee N, Somasundaram K. Cell cycle arrest and apoptosis
induction by activator protein 2a (AP-2α) and the role of p53
and p21WAF1/CIP1 in AP-2α-mediated growth inhibition. J Biol
Chem 2003; 278: 52 093_101.
29 Wajapeyee N, Raut CG, Somasundaram K. Activator protein
2a status determines the chemosensitivity of cancer cells:
implications in cancer chemotherapy. Cancer Res 2005; 65: 8628_34.
30 Wajapeyee N, Britto R, Ravishankar HM, Somasundaram K.
Apoptosis induction by activator protein 2a involves
transcriptional repression of Bcl-2. J Biol Chem 2006; 281: 16 207_19.
31 Porter AG, Janicke RU. Emerging roles of caspase-3 in apoptosis.
Cell Death Differ 1999; 6: 99_104.
|
