Extract
Note: Please read the complete
full text with Figures and Tables at
Introduction
The Chinese herb Han-Fang-Ji (Stephania tetrandra
S Moore) has been used in the therapy of rheumatic disorders
for a long time in China[1]. The main bioactive component
tetrandrine (TET) is a bisbenzylisoquinoline alkaloid with
anti-inflammatory, anti-allergic, antioxidant, antifibrogenic,
and antithrombogenic properties[2_5]. TET has been used to
treat patients with silicosis, autoimmune disorders, and
hypertension for decades. The antitumor properties of TET
have also been demonstrated in various cancer models. The
chemical structure of TET is illustrated in Figure 1.
Recently, in vitro research has shown that TET inhibits
cellular proliferation through the suppression of cytokine
production including interferon-g, interleukin (IL)-4, IL-2, and
IL-10. TET also inhibited IκBα kinases and protein kinase C
activity[6,7], and prevented tumor necrosis
factor-a (TNF-α) production in activated
monocytes[8]. In addition, TET was found to have an inhibitory effect on calcium-dependent
TNF-α production in glia-neuron mixed
cultures[9].
Microglia comprise 12% of the cell population in the
central nervous system (CNS)[10], and exist in multiple
morphological states in healthy and injured brains. Microglia
express surface markers similar to those of macrophages in
peripheral tissues, thus are macrophage-like cells resident
within the CNS. Moreover, microglia can mediate the
initiation of inflammation in the CNS. Recent experimental
evidence demonstrates that inflammation mediated by
microglia contributes to neurodegenerative diseases, including
Parkinson's disease and Alzheimer's
disease[11_13]. Activated microglia were shown to be capable of releasing various
molecules, such as nitric oxide (NO), superoxide anion
(O2_), IL-6, and TNF-α. Although NO was reported to play a role in
the protection of neuron apoptosis, it was likely that NO at
higher concentrations, mainly generated by inducible NO
synthase (iNOS), exerted their detrimental effects on
neuronal cells[14]. Furthermore, pro-inflammatory cytokines
generated by activated microglia, such as IL-6 and
TNF-α, have been reported to play important roles in neuronal injury and
apoptosis[15]. Thus, more research has been done on the
components that might inhibit microglial activation.
TET is known as a potent anti-inflammatory component.
We performed studies on cultured microglial to address
whether TET could suppress the activation of microglia.
Rat-derived microglial cultures were established. The microglia
pretreated with or without TET were stimulated by
lipopolysaccharide (LPS) in vitro. Our results indicated that
TET pretreatment inhibited NO release,
O2_ generation, as well as
TNF-α and IL-6 production by microglia. These effects of TET may be attributed to its inhibitory effect on the
NF-κB pathway during microglial activation.
Materials and Methods
Reagents Tetrandrine (purity >98%) was purchased from
Huike Botanical Development (Shanxi, China). LPS from
Escherichia coli (serotype 026:B6) was purchased from Sigma
(St Louis, MO, USA). The enzyme-linked immunosorbent
assay (ELISA) kits specific for rat TNF-α and IL-6 were
purchased from R&D Systems (Minneapolis, MN, USA).
Nucleotide oligomers were synthesized by Invitrogen (Carlsbad,
CA, USA).
Microglia cultures and TET pretreatment Primary
microglia culture was performed as described by Xiao
et al[16]. Briefly, the brains were isolated from Sprague_Dawley
rats (Shanghai SLAC Laboratory Animal, Shanghai, China) at
postnatal d 1-3. After the meninges were carefully
removed, the brains were minced mechanically.
Dissociated cells were resuspended in Dulbecco's modified
Eagle's medium supplemented with 10% fetal bovine
serum and seeded in 75-cm2 flasks at a density of
1×106 cells/mL. The cells were cultured in an incubator under 5%
CO2 at 37 °C, and the medium was changed every 3 d.
After 10 d, microglia growing on the surface of adherent astrocytes were removed
by shaking for 4 h at 150 r/min, and the floating cells were
collected and transferred to a 6-well plate at a density of
2×106 cells in 2 mL culture medium per well for 12 h before further
treatment. The purity was 92%_95% for microglia as
determined by anti-Mac-1 antibody (SeroTec, Oxford, UK) staining.
In all the experiments, the cells were pretreated with TET (25
or 50 µmol/L) for 2 h before the addition of LPS (1
µg/mL). Control samples were pretreated with the culture medium
only.
The study was performed according to the international,
national, and institutional rules concerning animal
experiments and biodiversity rights.
Measurement of nitrite The production of NO was
determined by measuring nitrite, a stable derivation of NO, which
reflects accumulated NO in the medium, using the Griess
reagents (1% sulphanilamide, 5% phosphoric acid, and 0.1%
naphthylethylenediamine). This assay was based on a
diazotization reaction that was originally described by Griess in
1879[17]. Briefly, 100 µL of sample prepared from cells were
mixed with 100 µL of Griess reagent in a 96-well flat plate.
After 10 min, the plate was mounted in an automated
microplate reader at 540 nm. The concentration of nitrite was
determined by reference to a standard curve of sodium nitrite.
Blank culture medium only was used as the control.
Measurement of
O2_
generation Superoxide radicals were generated by oxidation of NADH and analyzed by the
reduction of nitroblue tetrazolium (NBT). In brief, the
superoxide radicals were generated in 0.3 mL Tris-HCl buffer (16
mmol/L, pH 8.0) mixed with 0.1 mL NBT solution (50 mmol/L),
0.1 mL NADH solution (78 mmol/L), and an aliquot of the cell
culture supernatant (20 µL). The reaction was initiated by
adding 0.1 mL phenazine methosulphate solution (10
mmol/L) to the mixture. The reaction mixture was incubated at 25 °C
for 5 min, and the absorbance at 550 nm in an automated
microplate reader was measured against blank samples. L-Ascorbic acid was used as a negative control.
Analysis of cytokines TNF-α and IL-6 were
quantified using a sandwich ELISA procedure. In brief, the wells
of the microtiter plates were coated and stored overnight
at room temperature with 100 µL phosphate-buffered
saline (PBS) containing the appropriate dilutions of mouse
antirat TNF-α antibody and mouse antirat IL-6 antibody.
The coating was done at room temperature and kept overnight. The wells were then washed with 0.05% PBS
(PBS_Tween-20) and blocked with 100 µL of 1% bovine
serum albumin in PBS for 1 h at room temperature. After
washing, 100 µL of the culture supernatants were added to the
well in triplicates. After 2 h of incubation at room
temperature, the wells were washed and incubated with 100 µL (0.4 mg/L)
of biotinylated monoclonal antibodies (goat anti-rat
TNF-α and goat anti-rat IL-6 antibodies) for 2 h at room temperature.
After washing, 100 µL of streptavidin-horseradish
peroxidase conjugates were added, and the plates were incubated
for a further 45 min. After washing, 100 µL of substrate
solution was then added to each well. The reaction was
stopped after 20 min with a stopping solution. Optical
density was measured at a wavelength of 450 nm and a reference
wavelength of 540 nm. Density values were correlated
linearly with the concentrations of cytokine standards
(expressed in pg/mL).
Isolation of total RNA and RT_PCR Total RNA was
isolated from cell pellets using the RNeasy mini kit (Qiagen,
Hilden, Germany). Genomic DNA was removed from total
RNA prior to cDNA synthesis by DNase digestion using the
RNase-free DNase Set (Qiagen, Germany). RNA was stored
at _80 oC. First-strand cDNA synthesis was performed for
each RNA sample using the Sensiscript RT kit (Qiagen,
Germany). Random hexamers were used to prime cDNA
synthesis.
Real-time PCR The gene expression of iNOS was
performed by real-time PCR using SYBR green master mix
(Applied Biosystems, Foster City, CA, USA). The thermocycler conditions comprised an initial holding at
50 °C for 2 min, then 95 °C for 10 min. Reaction mixtures were
cycled 40 times at 95 °C for 15 s and 60 °C for 60 s. Data were
collected and quantitatively analyzed on an ABI
Prism 7900 sequence detection system (Applied Biosystems, USA). The
β-actin gene was used as an endogenous control to
normalize differences in the amount of total RNA in each sample.
All quantities were expressed in the number of folds relative
to the expression of β-actin.
β-actin, sense: 5' TTCAACACCCCAGCCATGT 3' and antisense: 5' GTGGTACGACCAGAGGCATACA 3' , and
iNOS, sense: 5' CGGTTCACAGTCTTGGTGAAAG 3´ and
antisense: 5' ACGCGGGAAGCCATGAC 3' .
Electrophoretic mobility shift assay After treatment with
LPS (1 µg/mL) with or without TET for 24 h, microglia were
collected. Buffer A (10 mmol/L HEPES, pH 7.9, 1.5 mmol/L
MgCl2, 10 mmol/L KCl, 1 mmol/L phenylmethylsulfonyl
fluoride [PMSF] and 1 mmol/L dithiothreitol [DTT]) was then
added to the cells and incubated at 4 °C for 15 min, and 1.06
µL Nonidet P-40 (10%) was added. After centrifugation,
the supernatant was removed and a high-salt solution (20
mmol/L HEPES, pH 7.9, 25% glycerol, 420 mmol/L NaCl,
1.5 mmol/L MgCl2, 0.2 mmol/L EDTA, 1 mmol/L PMSF,
and 1 mmol/L DTT) was added to the pellet. The
resuspended pellet was incubated for 60 min at 4 °C, and then
the supernatant was collected and used for the experiment.
Protein concentrations were determined using a protein
assay (Bio-Rad, Hercules, CA, USA). Synthetic
double-stranded oligonucleotides for the consensus
NF-κB binding sequence, 5' -AGTTGAGGGGACTTTCCCAGGC-3' , were
labeled with [γ-32P]dATP using T4 polynucleotide kinase
(Promega, Madison, WI, USA). The nuclear extract from
cultured cells was incubated with the labeled probe in Gel
shift binding buffer (Promega, USA) at 4 °C for 30 min.
DNA_protein complexes were resolved by electrophoresis in 4%
polyacrylamide gels with 0.5×Tris-borate buffer at 4 °C and
visualized by phorsphorimaging.
Statistical analysis All data are presented as mean±SD.
Statistical comparisons between 2 different treatments were
analyzed using the Student's t-test. Differences among more
than 2 groups were tested by one-way ANOVA. The levels
of significance were set to α=0.05. All tests were 2
tailed
Results
TET inhibited NO release and iNOS mRNA expression
in LPS-activated microglia When rat primary microglial cells
were stimulated with LPS in vitro, a strong induction of NO
production was observed. The production of NO was
determined by the measurement of nitrite, a stable product of NO,
as an indicator to the accumulated NO in the medium (Figure
2A). Cultured microglia without LPS stimulation produced
minimal NO in the supernatant. However, while stimulated
by LPS (1 µg/mL for 24 h), microglia released significantly
higher levels of NO from 1.11±0.06 to 23.89±0.25 µmol/L. The
pretreatment of microglia with TET significantly reduced the
elevation of NO release in a dose-dependent manner. The
nitrite concentration was reduced to 22.57±0.10 (TET 25 µmol/L)
and 13.34±0.28 (TET 50 µmol/L), respectively.
The cytotoxicity of TET was determined by LDH assay.
There was no significant difference in LDH release between
TET-treated and non-treated microglia. Therefore, the
observed inhibition of NO was not due to the cytotoxicity of
TET in microglia (data not shown).
In endotoxin-stimulated immune cells, iNOS is
responsible for NO production. Therefore, we investigated whether
TET suppressed iNOS expression induced by LPS. As shown
in Figure 2B, TET downregulated the level of iNOS gene
expression in LPS-activated microglia in a dose-dependent
manner. These results suggest that TET regulates NO
production in LPS-activated microglia via an iNOS-dependent
pathway.
TET inhibited O2_ production in LPS-activated
microglia The LPS stimulation of microglia leads to the activation
of NADPH oxidase and the production of reactive oxygen
species (ROS), including O2_, which are ultimately
responsible for the cellular oxidative
damage[18]. We then tested whether TET could reduce the
O2_ generated by microglia stimulated with LPS. As shown in Figure 3, TET
pretreatment inhibited LPS-stimulated
O2_ production in microglia in
a dose-dependent manner. The inhibition reached a maximal
value (35% reduction as compared to the control group)
at a TET dose of 50 µmol/L.
TET inhibited TNF-α and IL-6 release from
LPS-activated microglia TNF-α and IL-6 generated by activated
microglia play important roles in neurodegenerative
diseases[19]. To examine the effect of TET on cytokine production by
microglia, microglial cells were pretreated with TET for 2 h,
followed by treatment with 1 µg/mL LPS for 24 h. The
supernatants were then subjected to cytokine measurement. LPS
stimulation markedly increased the TNF-α and IL-6 levels
(Figure 4), which were significantly inhibited by TET
pretreatment in a dose-dependent manner. Therefore, TET
effectively suppressed the production of pro-inflammatory
cytokines by activated microglia.
Effects of TET on the LPS-induced activation of
NF-κB Because the NF-κB pathway is initially involved in
LPS-induced microglial activation, we used the electrophoretic
mobility shift assay (EMSA) to examine whether
NF-κB activity in microglia was affected by TET treatment. Microglia
were pretreated with TET (50 µmol/L) for 2 h and then
stimulated with LPS (1 µg/mL) for 24 h. Nuclear
extracts were prepared and EMSA was performed with a
NF-κB consensus oligonucleotide. In microglia activated with LPS, nuclear
NF-κB binding activity was enhanced (Figure 5A,5B). However,
TET pretreatment dramatically abolished NF-κB specific
binding induced by LPS, indicating that TET might downregulate
the production of inflammatory mediators through the
blockage of NF-κB activation.
Discussion
To date, the role of microglia and whether they are
neuroprotective or neurotoxic in the disease state of CNS remains
controversial. Available evidence indicates that neurotrophic
factors produced by activated microglia have a positive
effect on the survival of neuronal cells. Nevertheless,
microglial activation was also associated with neurodegenerative
diseases. In microglial and neuronal coculture systems,
microglial activation induced neuronal cell death by the release of
NO, superoxide, and pro-inflammatory
cytokines[20,21]. The inhibition of microglial activation could reduce neuronal cell
death. In fact, studies of pathogenic events mediated by
microglial activation in neurodegenerative diseases indicate
that antineuroinflammatory agents have neuroprotective
effects in these diseases. For example, many agents suppressed
microglia-mediated neurotoxicity by inhibiting
TNF-α, NO, or superoxide production, therefore exerting a neuroprotective
effect[22_25].
TET exhibits immunosuppressive properties both
in vitro and in vivo. In
vitro, TET inhibited the production of NO in LPS-activated
macrophages[26]. TET also inhibited the
secretion of TNF-α by activated
monocytes[8] and had an effect on cytokine production by activated T
cells[27]. In a rat model of silicosis, TET effectively blocked the ability of
quartz to stimulate oxidant release from pulmonary
phagocytes[28]. Consistent with these studies, we demonstrated
for the first time that TET showed significant suppressive
effects on LPS-induced microglial activation.
Our data showed that TET inhibited iNOS mRNA
expression and NO production in LPS-stimulated microglia. The
high sensitivity of neurons to NO damage is partly due to
the inhibition of respiration, rapid glutamate release, and
subsequent excitotoxic damage. In our study, we also
examined the amount of neuronal nitric oxide synthase (nNOS)
and endothelial nitric oxide synthase (eNOS) mRNA
expression with real-time PCR, but found them undetectable in
microglia (data not shown).
We also found that TET dose dependently inhibited the
generation of O2_.
O2_ is a short-lived free radical with
important physiological functions. As an oxidant, it can in
particular circumstances lead to the production of a variety of
other stronger oxidants, such as hydrogen peroxide, the
hydroxyl radical, hypochlorous acid, or peroxynitrite, all of
which are cytotoxic. When appropriately stimulated,
microglia can produce extracellular superoxide at very high
rates[29]. In addition, NO can stimulate mitochondrial superoxide
production and generate peroxynitrite within the mitochondria,
which can irreversibly inhibit mitochondrial respiration or
induce permeability transition[30]. The decline of
O2_ production as a result of TET treatment indicated a potential
regulatory role of TET on ROS and the spread of neuronal damage
during the development of inflammation and infection in the
CNS. In previous studies, TET was also found to scavenge
oxygen-derived free radicals directly in the cell-free
hypoxanthine-xanthine oxidase
system[31]. Therefore, whether the suppression of superoxide by TET resulted partially from
the direct scavenging action needs further study.
Furthermore, our results illustrated that TET modulated
the microglial production of TNF-α and IL-6, found to be
secreted at a very early stage of CNS inflammation.
TNF-α and IL-6 are elevated in most neurodegenerative diseases
and there is evidence that they play critical roles in disease
pathology. For example, TNF-α is a known potent inducer of
cellular adhesion molecules in cerebrovascular endothelial
cells[32] and astrocytes[33]. It can also induce chemokine
expression in microglia[34,35] and
astrocytes[35,36], thus promoting demyelination and oligodendrocyte
injury[37]. IL-6 is also important for inflammatory response and is involved in
reactive gliosis[38]. Therefore, augmentation of
TNF-α and IL-6 leads to CNS inflammation and damage.
NF-κB is a major transcriptional factor for the
induction of inflammation-related molecules. In resting cells,
through masking the nuclear localization signal,
NF-κB transcription factors are retained in the cytosol by inhibitory
proteins, including inhibitory κBα (IκBα), IκBβ,
IκBε, and IκBγ. After receiving a stimulatory signal, such as LPS, the
IκBα inhibitory protein is phosphorylated by IκBα kinases,
resulting in its ubiquitination and subsequent degradation
by proteasome. These sequential yet highly regulated
signal transduction events then cause nuclear translocation of
NF-κB transcription factors[39]. NF-κB in the nucleus binds
to the regulatory region in the gene promoter and is
involved in the induction of iNOS and pro-inflammatory
cytokines, including TNF-α and IL-6, in activated microglia. TET
has been found to intervene with NF-κB activation and nuclear
translocation in several cell
lines[7,40]. TET could also prevent the degradation of
IκBα and inhibit the nuclear translocation of p65 by blocking the activities of
IκBα kinases a and b in human peripheral blood T
cells[39]. Our findings in this study suggested that TET exerted its inhibitory effect
on LPS-induced microglial activation by blocking the
NF-κB-dependent pathway.
In conclusion, our results indicate for the first time that
TET suppresses LPS-induced microglial activation and
reduces the release of inflammatory mediators, including NO,
O2_, and pro-inflammatory cytokines. Such suppressive
effects are likely to be carried out through the inhibition of
NF-κB activation. Together with previous experimental evidence
that the suppression of microglial activation protects
neuronal cells from various injuries, our findings raise the
possibility of using TET in the treatment of neurodegenerative
diseases.
References
1 Ho LJ, Lai JH. Chinese herbs as immunomodulators and
potential disease-modifying antirheumatic drugs in autoimmune
disorders. Curr Drug Metab 2004; 5: 181_92.
2 Xie QM, Tang HF, Chen JQ, Bian RL. Pharmacological actions
of tetrandrine in inflammatory pulmonary diseases. Acta
Pharmacol Sin 2002; 23: 1107_13.
3 Lai JH. Immunomodulatory effects and mechanisms of plant
alkaloid tetrandrine in autoimmune diseases. Acta Pharmacol
Sin 2002; 23: 1093_101.
4 Rao MR. Effects of tetrandrine on cardiac and vascular
remodeling. Acta Pharmacol Sin 2002; 23: 1075_85.
5 Shi X, Mao Y, Saffiotti U, Wang L, Rojanasakul Y, Leonard SS,
et al. Antioxidant activity of tetrandrine and its inhibition of
quartz-induced lipid peroxidation. J Toxicol Environ Health 1995;
46: 233_48.
6 Chen F, Sun S, Kuhn DC, Lu Y, Gaydos LJ, Shi X,
et al. Tetrandrine inhibits signal-induced NF-kappa B activation in rat alveolar
macrophages. Biochem Biophys Res Commun 1997; 231:
99_102.
7 Ho LJ, Chang DM, Lee TC, Chang ML, Lai JH. Plant alkaloid
tetrandrine downregulates protein kinase C-dependent signaling
pathway in T cells. Eur J Pharmacol 1999; 367: 389_98.
8 Ferrante A, Seow WK, Rowan-Kelly B, Thong YH. Tetrandrine,
a plant alkaloid, inhibits the production of tumour necrosis
factor-alpha (cachectin) by human monocytes. Clin Exp Immunol
1990; 80: 232_5.
9 Wang B, Yang L, Yan HL, Wang M, Xiao JG. Effect of tetrandrine
on calcium-dependent tumour necrosis factor-alpha production
in glia-neurone mixed cultures. Basic Clin Pharmacol Toxicol
2005; 97: 244_8.
10 Gremo F, Sogos V, Ennas MG, Meloni A, Persichini T, Colasanti
M, et al. Features and functions of human microglia cells. Adv
Exp Med Biol 1997; 429: 79_97.
11 Ryu JK, Shin WH, Kim J, Joe EH, Lee YB, Cho KG,
et al. Trisialoganglioside GT1b induces
in vivo degeneration of nigral dopaminergic neurons: role of microglia. Glia 2002; 38: 15_23.
12 Iadecola C, Zhang F, Xu S, Casey R, Ross ME. Inducible nitric
oxide synthase gene expression in brain following cerebral
ischemia. J Cereb Blood Flow Metab 1995; 15: 378_84.
13 Paresce DM, Chung H, Maxfield FR. Slow degradation of
aggregates of the Alzheimer's disease amyloid beta-protein by
microglial cells. J Biol Chem 1997; 272: 29 390_7.
14 Bal-Price A, Brown GC. Nitric-oxide-induced necrosis and
apoptosis in PC12 cells mediated by mitochondria. J Neurochem
2000; 75: 1455_64.
15 Combs CK, Karlo JC, Kao SC, Landreth GE. Beta-amyloid
stimulation of microglia and monocytes results in
TNF-αlpha-dependent expression of inducible nitric oxide synthase and neuronal
apoptosis. J Neurosci 2001; 21: 1179_88.
16 Xiao BG, Diab A, Zhu J, van der Meide P, Link H. Astrocytes
induce hyporesponses of myelin basic protein-reactive T and B
cell function. J Neuroimmunol 1998; 89: 113_21.
17 Griess P. Bemerkungen zu der abhandlung der H.H.Weselsky und
Benedikt "Ueber einige azoverbindungen". Chem Ber 1879; 12:
426_8.
18 McDonald DR, Brunden KR, Landreth GE. Amyloid fibrils
activate tyrosine kinase-dependent signaling and superoxide
production in microglia. J Neurosci 1997; 17: 2284_94.
19 Takeuchi H, Jin S, Wang J, Zhang G, Kawanokuchi J, Kuno R,
et al. Tumor necrosis factor-alpha induces neurotoxicity via
glutamate release from hemichannels of activated microglia in
an autocrine manner. J Biol Chem 2006; 281: 21 362_8.
20 Le W, Rowe D, Xie W, Ortiz I, He Y, Appel SH. Microglial
activation and dopaminergic cell injury: an in
vitro model relevant to Parkinson's disease. J Neurosci 2001; 21: 8447_55.
21 Brown GC, Bal-Price A. Inflammatory neurodegeneration
mediated by nitric oxide, glutamate, and mitochondria. Mol Neurobiol
2003; 27: 325_55.
22 Liu B, Jiang JW, Wilson BC, Du L, Yang SN, Wang JY,
et al. Systemic infusion of naloxone reduces degeneration of rat
substantia nigral dopaminergic neurons induced by intranigral
injection of lipopolysaccharide. J Pharmacol Exp Ther 2000; 295:
125_32.
23 Liu B, Du L, Hong JS. Naloxone protects rat dopaminergic
neurons against inflammatory damage through inhibition of
microglia activation and superoxide generation. J Pharmacol Exp
Ther 2000; 293: 607_17.
24 Kowalski J, Labuzek K, Herman ZS. Flupentixol and trifluperidol
reduce secretion of tumor necrosis factor-α and nitric oxide by
rat microglial cells. Neurochem Int 2003; 1289: 1_6.
25 Li R, Huang YG, Fang D, Le WD. (_)-Epigallocatechin gallate
inhibits lipopolysaccharide-induced microglial activation and
protects against inflammation-mediated dopaminergic neuronal
injury. J Neurosci Res 2004; 78: 723_31.
26 Kondo Y, Takano F, Hojo H. Inhibitory effect of
bisbenzylisoquinoline alkaloids on nitric oxide production in activated
macrophages. Biochem Pharmacol 1993; 46: 1887_92.
27 Lai JH, Ho LJ, Kwan CY, Chang DM, Lee TC. Plant alkaloid
tetrandrine and its analog block CD28-costimulated activities of
human peripheral blood T cells: potential immunosuppressants
in transplantation immunology. Transplantation 1999; 68:
1383_92.
28 Castranova V. Generation of oxygen radicals and mechanisms of
injury prevention. Environ Health Perspect 1994; Suppl 10:
65_8.
29 Bal-Price A, Matthias A, Brown GC. Stimulation of the NADPH
oxidase in activated rat microglia removes nitric oxide but induces
peroxynitrite production. J Neurochem 2002; 80: 73_80.
30 Riobo NA, Clementi E, Melani M, Boveris A, Cadenas E, Moncada
S, et al. Nitric oxide inhibits mitochondrial NADH: ubiquinone
reductase activity through peroxynitrite formation. Biochem J
2001; 359: 139_45.
31 Seow WK, Ferrante A, Li SY, Thong YH. Antiphagocytic and
antioxidant properties of plant alkaloid tetrandrine. Int Arch
Allergy Appl Immunol 1988; 85: 404_9.
32 Grau GE, Lou J. TNF in vascular pathology: the importance of
platelet-endothelial interactions. Res Immunol 1993; 144:
355_63.
33 Satoh J, Kastrukoff LF, Kim SU. Cytokine-induced expression
of intercellular adhesion molecule-1 (ICAM-1) in cultured
human oligodendrocytes and astrocytes. J Neuropathol Exp Neurol
1991; 50: 215_26.
34 McManus CM, Brosnan CF, Berman JW. Cytokine induction of
MIP-1α and MIP-1β in human fetal microglia. J Immunol 1998; 160:
1449_55.
35 Hayashi M, Luo Y, Laning J, Strieter RM, Dorf ME. Production
and function of monocyte chemoattractant protein-1 and other
β-chemokines in murine glial cells. J Neuroimmunol 1995; 60: 143_50.
36 Hurwitz AA, Lyman WD, Berman JW. Tumor necrosis factor
α and transforming growth factor β upregulate astrocyte
expression of monocyte chemoattractant protein-1. J Neuroimmunol
1995; 57: 193_8.
37 Louis JC, Magal E, Takayama S, Varon S. CNTF protection of
oligodendrocytes against natural and tumor necrosis
factor-induced death. Science 1993; 259: 689_92.
38 Klein MA, Moller JC, Jones LL, Bluethmann H, Kreutzberg GW,
Raivich G. Impaired neuroglial activation in
interleukin-6-deficient mice. Glia 1997; 19: 227_33.
39 Ho LJ, Juan TY, Chao P, Wu WL, Chang DM, Chang SY,
et al. Plant alkaloid tetrandrine downregulates IkappaBalpha
kinases-IkappaBalpha-NF-kappaB signaling pathway in human
peripheral blood T cell. Br J Pharmacol 2004; 143: 919_27.
40 Chen F, Sun S, Kuhn DC, Lu Y, Gaydos LJ, Shi X,
et al. Tetrandrine inhibits signal-induced NF-kappa B activation in rat alveolar
macrophages. Biochem Biophys Res Commun 1997; 231:
99_102.
|
