Extract
Note: Please read the complete
full text with Figures and Tables at
Introduction
Osteosarcoma is a common primary malignant tumor of bones in children and adolescents, characterized by an
extremely aggressive clinical course with rapid development of
metastases[1_3]. The first choice of treatment for
osteosarcoma is neoadjuvant chemotherapy. Many anticancer drugs, such as methotrexate (MTX), doxorubicin, cisplatin, etoposide,
and cyclophosphamide are commonly used,
either alone or in combination[4,5]. Although the adoption of adjuvant and neoadjuvant chemotherapy has significantly
improved the prognosis, a considerable number of osteosarcoma patients develop drug resistance and die as a result of
disease progression[1,4,5].
MTX, one of the most important drugs in osteosarcoma
treatment, is a potent inhibitor of the dihydrofolate
reductase (DHFR) enzyme. DHFR catalyzes the reduction of folate
and 7,8dihydrofolate to 5,6,7,8tetrahydrofolate.
Resistance to MTX can arise through several
mechanisms[6_8]. In osteosarcomas, these mechanisms include
increased levels of the DHFR enzyme because of DHFR gene
overexpression, and impaired intracellular transport of MTX,
as a consequence of decreased levels of the reduced folate
carrier in the cell membrane[9]. Enhanced levels of DHFR are
frequently present in proliferating tumor cells, which can be
associated with the amplification of the DHFR gene. Thus,
new treatments that circumvent the mechanisms responsible
for drug resistance could become the basis for innovative
therapeutic regimens aimed at increasing the drug response
rate and improving the clinical outcome of
patients[10,11].
Bufalin is a major digoxin-like immunoreactive
component of "Chan'Su", a traditional Chinese medicine obtained
from the skin and parotid venom glands of
toads[12_14]. Bufalin has been reported to exhibit significant antitumor activity
against human leukemia cells[15_17], endometriotic stromal
cells[18], and prostate cancer
cells[19]. Its activities are mediated by the induction of apoptosis and cell differentiation;
the regulation of various genes and proteins is also involved
in the process.
Although the antitumor activities of bufalin have been
analyzed in several tumors, no data have been reported so
far about its effectiveness on human osteosarcoma cells.
Thus, we evaluated the effects of bufalin on the proliferation,
cell cycle arrest, and apoptosis in human osteosarcoma
U-2OS and U-2OS/MTX300 cell lines. Moreover, we assessed
the effect of bufalin on the DHFR expression. The aim of this
study was to determine the effects of this agent on human
osteosarcoma cell lines in vitro to assess whether it might
be useful for alternative chemotherapeutic regimens in
osteosarcoma patients unresponsive (resistant) to MTX.
Materials and methods
Drugs and reagents Bufalin and MTX were purchased
from Sigma Chemical Co (St Louis, MO, USA) Doxorubicin,
cisplatin, and paclitaxel were purchased from the National
Institute for the Control of Pharmaceutical and Biological
Products (Beijing, China). Stock solutions of these drugs
were stored at 4 °C. Working concentrations were then
prepared by diluting stock solutions in culture medium
immediately before use.
MTT (methyl thiazolyl tetrazolium) and Hoechst 33258
were purchased from Sigma Chemical Co (USA) The DNAzol
and TRIzol reagents were purchased from Invitrogen Life
Technologies (Paisley, Scotland, UK) and Gibco BRL (Grand
Island, NY, USA), respectively. Reagents for RT-PCR were
from Toyobo (Osaka, Japan). Antibodies to DHFR were
purchased from Becton-Dickinson (Mountain View, CA, USA).
Antibodies to Bax, Bcl-2, p53, p21, and β-actin were obtained
from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
Cell lines and culture The human osteosarcoma cell
lines U-2OS and U-2OS/MTX300 were gifts from Dr M SERRA
(Istituti Ortopedici Rizzoli, Bologna, Italy). Starting with the
MTX-sensitive U-2OS osteosarcoma cell line, the
MTX300-resistant variant was obtained by exposing the parental line
in vitro to stepwise increased MTX
concentrations[20]. Such continuous exposure to MTX resulted in cells resistant to
300 µg/L (U-2OS/MTX300). The MTX300-resistant variant
was continuously cultured in the presence of 300 µg/L MTX.
All of the cells were cultured in Iscove's modified Dulbecco's
medium (IMDM, Gibco BRL, USA), supplemented with 10%
fetal calf serum (Hyclone, Logan, UT, USA), penicillin
(10 000 U/L), and streptomycin (100 mg/L) at 37 °C in a 5%
CO2 humidified atmosphere.
MTT assay The effects of bufalin on cell proliferation
and the viability of U-2OS and U-2OS/MTX300 cells were
assessed using the MTT assay. U-2OS and U-2OS/MTX300
cells were harvested and seeded in 96-well plates at
6.0×103 cells/well in a final volume of 180 µL. After 24 h of incubation,
drugs were added to duplicate plates at appropriate
concentrations. After 92 h, MTT solution (10 µL) was added
to each well. DMSO (100 µL) was added to each well 4 h
later. The concentrations required to inhibit cell growth by
50% (IC50) were calculated from the cytotoxicity curves
(Bliss's software; Bliss Co, CA, USA). The degree of
resistance was calculated by dividing the
IC50 for the U-2OS/MTX300 cells by that of the parental MTX-sensitive cells.
The IC50 values were calculated from at least 3 independent
experiments.
Fluorescent staining The cells treated with the
indicated concentrations of bufalin for 48 h were collected by
centrifugation (1500×g, 5 min), washed twice with phosphate
buffered saline (PBS), and stained with the DNA-specific
dye Hoechst 33258 (10 mL, 10 mg/L). The cells were then
incubated at 37 °C for 10 min and again washed in PBS for
morphological observation using an Olympus
photomicroscope with an epifluorescence attachment (Tokyo, Japan).
Cells displaying condensed, fragmented DNA were deemed
apoptotic.
DNA fragmentation assay The integrity of the cells'
genomic DNA was assessed by agarose gel electrophoresis.
The cells (1×106) were added to DNAZOL (genomic DNA
isolation) reagent (0.5 mL) and lysed by agitation. The
lysate was gently pipetted into an assay tube, and the
homogenate was cleared by centrifugation (10 000×g, 10 min).
Following centrifugation, the resulting viscous supernatant
was transferred to a fresh tube, and DNA from the lysate was
precipitated by the addition of 100% ethanol (0.25 mL). The
precipitate was washed twice with 75% ethanol (0.8_1.0 mL).
After removing the ethanol, the DNA precipitate was
dissolved in NaOH solution (8 mmol/L). The DNA samples
were loaded on 2% agarose gels for electrophoresis. The
gels were stained with ethidium bromide (0.5 mg/L) and
photographed under UV illumination.
Western blot analyses The cells were washed in cold
PBS, then lysed and harvested by scraping with a protein
extraction reagent (Pierce Biotechnology, Rockford, USA).
Protein concentrations were determined using the Bradford
assay. For each sample, the protein extract (30 µg) was
separated on 15% SDS-PAGE and electroblotted onto
polyvinyli-dene difluoride membranes. The membranes were incubated
with primary antibodies for 12 h at 4 °C followed by 3 washes
in Tris-buffered saline with Tween-20 (TBST) for 5 min, and
were then incubated with horseradish peroxidase-conjugated
secondary antibody for 1 h at room temperature. Western
blot analyses were performed using anti-DHFR
(Becton-Dickinson, USA), antihuman Bax, antihuman p53, antihuman
p21, and antihuman Bcl-2 (Santa Cruz Biotechnology, USA)
monoclonal antibodies. Protein bands were visualized on
X-ray film using an enhanced chemiluminescence detection
system. For each sample, the amount of protein was
determined by densitometric analysis.
RT-PCR analysis The total RNA was extracted by using
TRIzol reagent, according to the manufacturer's protocol.
The total RNA (1 mg) was denatured at 65 °C for 10 min and
then reverse transcribed at 42 °C for 40 min in a reaction mix
(20 µL) containing 5×RT buffer, 10 mmol/L
deoxyribonucleotide triphosphate (dNTP) mix, 10 U/µL RNase inhibitor, and
10 µmol/L oligo (dT; ReverTra Ace, Toyobo, Japan). Part (2
µL) of each RT reaction was amplified using ReverTra Dash
(Toyobo, Japan) in a total volume of 100 µL. Transcripts of
the gene for glyceraldehydes-3-phosphate dehydrogenase
(G3PDH) were used as internal controls.
After incubating the mix at 94 °C for 2 min, 30 PCR cycles
were conducted, consisting of 94 °C for 1 min, annealing at
60 °C for 1 min, and elongation at 72 °C for 1 min with a 5 min
extension at 72 °C following the last cycle. For DHFR, the
primers were 5'GTAGAAGGTAAACAGAATCTG3' (forward intron-spanning) and 5'AGAACACCTGGG-TATTCTGG3'
(reverse intron-spanning), and for G3PDH, the primers were
5'ACCACAGTCCATGCCATCAC3' (forward) and 5'TCCA-CCACCCTGTTGCTGTA3' (reverse). The amplified samples
were then electrophoresed on 1.5% agarose gels containing
ethidium bromide (0.5 mg/L).
Statistical analysis All data were derived from at least 3
independent experiments and results are expressed as
mean±standard error. Differences were assessed using the
Student's t-test or the KruskalWallis test. A
P value of
<0.05 was deemed statistically significant.
Results
Effects of bufalin on the viability of the U-2OS and
U-2OS/MTX300 cell lines The effects of bufalin and other
drugs on the viability of U-2OS and U-2OS/MTX300 cells
were assessed using the MTT assay (Table 1). To
investigate the impact of MTX resistance, we first made a
comparison between U-2OS and U-2OS/MTX300 cells.
U-2OS/MTX300 were approximately 120-fold more resistant to MTX
than U-2OS. Bufalin showed a potent cytotoxic effect on
both U2OS and U-2OS/MTX300 cells. The
IC50 values of bufalin for U-2OS and U-2OS/MTX300 cells were 8.49±2.1
µg/L and 10.19±1.7 µg/L, respectively; these values were
not statistically significantly different
(P>0.05). The IC50 value of bufalin was similar to that of doxorubicin, although
significantly lower than that of cisplatin or paclitaxel.
U-2OS/MTX-300 cells showed no cross-resistance with
bufalin. Similar results were obtained with doxorubicin,
cisplatin, and paclitaxel.
The loss of viability could be the result of inducing
apoptosis, blocking the cell cycle at a specific point, such as
G2/M, or more generally, inhibiting growth. Thus, we next
investigated whether bufalin could induce apoptosis or block
the cell cycle in human osteosarcoma cells.
Effects of bufalin on apoptosis in the U-2OS and
U-2OS/MTX300 cell lines To examine whether bufalin could
induce apoptosis in human osteosarcoma U2OS cells and the
MTX-resistant variant, we first used fluorescent staining
with Hoechst 33258 (Figure 1). U-2OS and U-2OS/MTX300
cells were treated with bufalin (0, 10, 50, or 100 µg/L) for 48 h.
Fluorescent observation shown that bufalin could induce
apoptosis in both cell lines. The cells showed typical
apoptotic morphology characterized by volume reduction,
chromatin condensation, nuclear fragmentation, and the
appearance of apoptotic bodies.
Next, we used flow cytometry to assess the degree of
bufalin-induced apoptosis in U2OS cells and in
U-2OS/MTX300 cells. After incubation for 48 h, bufalin induced
apoptosis in U-2OS and U-2OS/MTX300 cells in a dose-
dependent manner (Figure 2). The
sub-G1 peak proportion was assessed and the difference was significant between
the bufalin-treated (10, 50, and 100 µg/L) and the control
cells.
To further assess the apoptotic effect of bufalin, we
examined genomic DNA fragmentation using agarose gel
electrophoresis and DNA staining. After incubating the cells
with bufalin (0, 10, 50, and 100 µg/L) for 48 h, the
characteristic "ladder" of the fragmented DNA was evident (Figure 3).
Effects of bufalin on the cell cycle in the U-2OS and
U-2OS/MTX300 cell lines The effects of bufalin on the cell
cycle in U-2OS and U-2OS/MTX300 cells were examined by
flow cytometry. After culture for 48 h in the presence of
bufalin (0, 10, 50, and 100 µg/L), accumulation of cells in the
G2/M phase was observed in both U-2OS and
U-2OS/MTX300 cells in a dose-dependent manner (Figure 4). A
concomitant decrease in the proportion of cells in the
G0/G1 phase was also seen in U-2OS cells, while no such decrease
was obvious in U-2OS/MTX300 cells. Similar results were
obtained in repeated experiments, suggesting that bufalin
leads to the accumulation of cells in the
G2/M phase in U-2OS and U-2OS/MTX300 cells.
Effects of bufalin on the expression of apoptosis-related
proteins in the U-2OS and U-2OS/MTX300 cell
lines Based on the apoptotic analysis, we next examined the expression
of apoptosis-related proteins. We confirmed intracellular
apoptotic events biochemically by examining the expression
levels of p53, p21, Bcl-2, and Bax. Bufalin had obvious
effects on p53, Bcl-2, and Bax in both cell lines (Figure 5).
The expression of Bcl-2 was downregulated in bufalin-treated
cells, while p53, p21, and Bax were upregulated with an
increase in the bufalin concentration from 10 to 100 µg/L. The
ratio of Bax/Bcl-2 increased dose dependently after bufalin
treatment. These results suggest that bufalin can induce
apoptosis in U-2OS and U-2OS/MTX300 cells by affecting
these apoptosis-related proteins. With regard to the
expression levels of p21, there was some difference between
U-2OS and U-2OS/MTX300 cells (Figure 5). In U-2OS/MTX300
cells, the induction of p21 was evident; however, in U-2OS
cells, there was no such difference between the
bufalin-treated and control cells.
Effects of bufalin on the gene expression and protein
levels of DHFR in the U-2OS and U-2OS/MTX300 cell lines
To assess whether bufalin could affect DHFR expression,
RT-PCR and Western blot analysis were conducted. After
treatment with bufalin (0, 10, 50, and 100 µg/L) for 48 h,
there was no obvious difference in DHFR at either the
mRNA or protein level (Figures 5, 6), suggesting that bufalin
does not affect DHFR expression in U-2OS and
U-2OS/MTX300 cells.
Discussion
Despite significant advances in the treatment of
osteosarcoma, the development of drug resistance is a
common clinical problem that significantly decreases the
effectiveness of chemotherapy in high-grade osteosarcoma
patients. Responsiveness to chemotherapy is a critical
factor that dramatically influences clinical
outcome[1,3_5]. A strategy that has been used is the search for new anticancer
agents in traditional medicine[21].
Bufalin is a major component of Chan Su, a traditional
Chinese medicine obtained from the skin and parotid venom
glands of toads. Bufalin has been shown to exhibit
antitumor activity by inhibiting the growth of and inducing
apoptosis in several tumor cells. The mechanism of
bufalin-induced apoptosis has been examined and includes the
activation of AP-1[16],
Rac1[17], cdc2 kinase and casein kinase
II[22], the induction of Tiam1
expression[17], and the elevation of intracellular calcium
concentrations[19]. Apoptosis-related proteins have also been examined; bufalin downregulates
the expression of cyclin A, Bcl-2, and Bcl-X(L) and
upregu-lates the expression of p21 and
Bax[15,18]. Jing et al reported
that apoptosis was not induced by bufalin in normal
mononuclear or polymorphonuclear
cells[23]. Nasu et al also indicated that bufalin induced apoptosis in endometriotic cyst
stromal cells; in contrast, only marginal effects were observed
in normal endometrial stromal cells[18]. The induction of cell
cycle arrest by bufalin also differed among
cells[18,23,24]; thus, the effects of bufalin may be cell-type specific.
To date, no data have been reported regarding the
activity of bufalin in osteosarcoma cells. To gain insight into the
effects of bufalin, we investigated its cytotoxicity and
efficacy in the human U-2OS cell line and its variant
U-2OS/MTX300. Our cell proliferation assays showed that bufalin
strongly inhibited the proliferation of U-2OS and
U-2OS/MTX300 in a dose-dependent manner. Based on these
results, we examined the morphological changes in the cells
by Hoechst 33258 staining (Figure 1). Flow cytometry
analysis was also used to examine the apoptosis-inducing effects
of bufalin (Figure 2). We also performed a DNA
fragmentation assay to examine a late marker of apoptosis. After the
U2OS cells were treated with bufalin at different
concentrations for 48 h, significant DNA fragmentation was detected
(Figure 3). In the cell cycle analysis, a significant increase in
the cell population in the G2/M phase was observed after 48
h treatment with bufalin (Figure 4), which was consistent
with previous studies[22,24].
To further examine the biological mechanism of
bufalin-induced apoptosis, we assessed the levels of the p53, p21,
Bcl-2, and Bax proteins by Western blot analysis. It is known
that the tumor suppressor protein p53 induces apoptosis
through several pathways and one of these involves
pro-apoptotic and anti-apoptotic proteins of the Bcl-2 family.
Members of the Bcl-2 family elicit opposing effects on
mitochondria. Bax is a target of p53 and is a member of the
Bcl-2 family that regulates apoptosis and cell prolifera-
tion[25,26]. Translocation of Bax to the mitochondria in
response to cell damage induces the mitochondrial
permeability transition, an event that releases cytochrome c and
culminates in the death of the
cells[27]. Bcl-2 is transcriptionally suppressed by p53, helping to preserve the integrity of
the mitochondria[28]. p21, a potent inhibitor of
cyclin-dependent kinases, is also a downstream effector of the p53
pathway of growth control[29].
We observed that bufalin increased the expression of
p53 and Bax, while it reduced the expression of Bcl-2 in both
U-2OS and U-2OS/MTX300 cells. Thus, the induction of
apoptosis in human osteosarcoma cells by bufalin was
associated with the p53 pathway and Bcl-2 family proteins.
Previous studies showed that the ratio of Bax to Bcl-2 (rather
than anti-apoptotic Bcl-2 alone) is important in cell survival
or apoptotic death in response to death
stimuli[30]. In our study, the average ratio of Bax/Bcl-2 in p53-containing U2OS
cells treated with bufalin was significantly higher than in the
control cells. These results further suggest that the
mechanism of bufalin-induced apoptosis in U2OS cells includes
the modulation of the ratio of Bax/Bcl-2 by p53.
In this study, we found that bufalin leads to the
accumulation of cells in the G2/M phase in both U-2OS and
U-2OS/MTX300 cells. A concomitant decrease in the proportion of
cells in the G0/G1 phase was also seen in U-2OS cells, while
no such decrease was obvious in U-2OS/MTX300 cells. The
extent of p21 induction was also different between U-2OS
and U-2OS/MTX300 cells; it was almost absent in the U-2OS
cell line. There are some differences between U-2OS and
U-2OS/MTX300 cells; specifically, U-2OS/MTX300 cells
showed a higher doubling time, a lower cloning efficiency,
and a lower metastatic ability after iv injection than the
corresponding parental cell line[31]. Thus, the differences in the
cell cycle and p21 induction between U-2OS and
U-2OS/MTX300 after treatment with bufalin may be due to these
different characteristics and should be studied further.
In our study, we were particularly interested in the
findings that bufalin retained its efficacy in MTX-resistant cells,
which have an increased level of
DHFR[10,11]. Studies have shown that an increase in DHFR levels is an important
mechanism responsible for the degree of clinical resistance to MTX
in osteosarcoma patients[9,10]. Thus, we sought to evaluate
DHFR gene expression and protein levels in bufalin-treated
U-2OS and U-2OS/MTX300 human osteosarcoma cells.
After treatment with bufalin for 48 h, there was no difference in
DHFR at the mRNA or protein level (Figures 5, 6),
suggesting that bufalin does not affect DHFR expression in U-2OS
or U-2OS/MTX300 cells. Furthermore, the
apoptosis-inducing effects of bufalin were apparently not affected by the
presence of high levels of DHFR protein. Indeed, bufalin
was able to induce apoptosis equally in both
MTX-sensitive and MTX-resistant cell lines without regard to and
without altering the DHFR expression. These data indicate the
lack of cross-resistance mechanisms between bufalin and
MTX, and that bufalin may be useful as an alternative
chemotherapeutic agent in osteosarcoma patients unresponsive
(resistant) to MTX.
In conclusion, we demonstrated that bufalin induced
apoptosis and G2/M phase cell cycle arrest in human
osteo-sarcoma U-2OS and U-2OS/MTX300 cells. The induction of
apoptosis is apparently mediated through a tumor
suppressor protein p53-dependent pathway, which involves proteins
of the Bcl-2 family. These results suggest that bufalin may
be applicable as a medical treatment for osteosarcoma. In
addition, data from our study indicate that bufalin has strong
activity, not only in MTX-sensitive U-2OS cells, but also in
MTX-resistant U-2OS/MTX300 cells, without being affected
by or affecting DHFR expression. These findings indicate
that bufalin may be useful as an alternative
chemotherapeutic agent in osteosarcoma patients unresponsive to MTX.
Acknowledgement
We thank Dr Massimo SERRA (Laboratorio di Ricerca
Oncologica, Istituti Ortopedici Rizzoli, Bologna, Italy) for
providing the U-2OS and U-2OS MTX300-resistant cell lines.
References
1 Ferguson WS, Goorin AM. Current treatment of osteosarcoma.
Cancer Invest 2001; 19: 292_315.
2 Bramwell VH. Osteosarcomas and other cancers of bone. Curr
Opin Oncology 2000; 12: 330_6.
3 Davis AM, Bell RS, Goodwin PJ. Prognostic factors in
osteosarcoma: a critical review. J Clin Oncol 1994; 12: 423_31.
4 Uchida A, Myoui A, Araki N, Yoshikawa H, Shinto Y, Ueda T.
Neoadjuvant chemotherapy for pediatric osteosarcoma patients.
Cancer 1997; 79: 411_5
5 Link MP, Goorin AM, Horowitz M, Meyer WH, Belasco J, Baker
A, et al. Adjuvant chemotherapy of high-grade osteosarcoma of
the extremity: updated results of the Multi-Institutional
Osteosarcoma Study. Clin Orthop Relat Res 1991; 270: 8_14.
6 Bertino JR, Goker E, Gorlick R, Li WW, Banerjee D. Resistance
mechanisms to methotrexate in tumors. Stem Cells 1996; 14:
5_9.
7 Slansky JE, Li Y, Kaelin WG, Farnham PJ. A protein
synthesis-dependent increase in E2F1 mRNA correlates with growth
regulation of the dihydrofolate reductase promoter. Mol Cell Biol
1993; 13: 1610_8.
8 Banerjee D, Mayer-Kuckuk P, Capiaux G, Budak-Alpdogan T,
Gorlick R, Bertino JR. Novel aspects of resistance to drugs
targeted to dihydrofolate reductase and thymidylate synthase.
Biochim Biophys Acta 2002; 1587: 164_73.
9 Guo W, Healey JH, Meyers PA, Ladanyi M, Huvos AG, Bertino
JR, et al. Mechanisms of methotrexate resistance in
osteo-sarcoma. Clin Cancer Res 1999; 5: 621_7.
10 Serra M, Reverter-Branchat G, Maurici D, Benini S, Shen JN,
Chano T, et al. Analysis of dihydrofolate reductase and reduced
folate carrier gene status in relation to methotrexate resistance
in osteosarcoma cells. Ann Oncol 2004; 15: 151_60.
11 Hattinger CM, Reverter-Branchat G, Remondini D, Castellani
GC, Benini S, Pasello M, et al. Genomic imbalances associated
with methotrexate resistance in human osteosarcoma cell lines
detected by comparative genomic hybridization-based techniques.
Eur J Cell Biol 2003; 82: 483_93.
12 Panesar NS. Bufalin radioimmunoassays: in search of the
endogenous digitalis-like substance. J Immunoassay 1994; 15:
371_91.
13 Hong Z, Chan K, Yeung HW. Simultaneous determination of
bufadienolides in the traditional Chinese medicine preparation,
Liu-Shen-Wan, by liquid chromatography. J Pharm Pharmacol
1992; 44: 1023_6.
14 Krenn L, Kopp B. Bufadienolides from animal and plant sources.
Phytochemistry 1998; 48: 1_29.
15 Watabe M, Kawazoe N, Masuda Y, Nakajo S, Nakaya K. Bcl-2
protein inhibits bufalin-induced apoptosis through inhibition of
mitogen-activated protein kinase activation in human leukemia
U937 cells. Cancer Res 1997; 57: 3097_100.
16 Watabe M, Ito K, Masuda Y, Nakajo S, Nakaya K. Activation of
AP-1 is required for bufalin-induced apoptosis in human
leukemia U937 cells. Oncogene 1998; 16: 779_87.
17 Kawazoe N, Watabe M, Masuda Y, Nakajo S, Nakaya K. Tiam1
is involved in the regulation of bufalin-induced apoptosis in
human leukemia cells. Oncogene 1999; 18: 2413_21.
18 Nasu K, Nishida M, Ueda T, Takai N, Bing S, Narahara H,
et al. Bufalin induces apoptosis and the G0/G1 cell cycle arrest of
endometriotic stromal cells: a promising agent for the treatment
of endometriosis. Mol Hum Reprod 2005; 11: 817_23.
19 Yeh JY, Huang WJ, Kan SF, Wang PS. Effects of bufalin and
cinobufagin on the proliferation of androgen dependent and
independent prostate cancer cells. Prostate 2003; 54: 112_24.
20 Serra M, Scotlandi K, Manara MC, Maurici D, Lollini PL, De
Giovanni C, et al. Establishment and characterization of
multidrug-resistant human osteosarcoma cell lines. Anticancer
Res 1993; 13: 323_9.
21 Rui H. Research and development of cancer chemopreventive
agents in China. J Cell Biochem Suppl 1997; 27: 7_11.
22 Numazawa S, Shinoki M, Ito H, Yoshida T, Kuroiwa Y.
Involvement of Na+,K+-ATPase inhibition in K562 cell differentiation
induced by bufalin. J Cell Physiol 1994; 160: 113_20.
23 Jing Y, Ohizumi H, Kawazoe N, Hashimoto S, Masuda Y, Nakajo
S, et al. Selective inhibitory effect of bufalin on growth of
human tumor cells in vitro: association with the induction of
apoptosis in leukemia HL-60 cells. Jpn J Cancer Res 1994; 85:
645_51.
24 Jing Y, Watabe M, Hashimoto S, Nakajo S, Nakaya K. Cell cycle
arrest and protein kinase modulating effect of bufalin on human
leukemia ML1 cells. Anticancer Res 1994; 14: 1193_98.
25 Borner C. The Bcl-2 protein family: sensors and checkpoints
for life-or-death decisions. Mol Immunol 2003; 39: 615_47.
26 Miyashita T, Reed JC. Tumor suppressor p53 is a direct
transcriptional activator of the human bax gene. Cell 1995; 80:
293_9.
27 Karpinich NO, Tafani M, Rothman RJ, Russo MA, Farber JL.
The course of etoposide-induced apoptosis from damage to DNA
and p53 activation to mitochondrial release of cytochrome c. J
Biol Chem 2002; 277: 16 547_52.
28 Ryan KM, Phillips AC, Vousden KH. Regulation and function of
the p53 tumor suppressor protein. Curr Opin Cell Biol 2001; 13:
332_7.
29 el-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R,
Trent JM, et al. WAF1, a potential mediator of p53 tumor
suppression. Cell 1993; 75: 817_25.
30 Salomons GS, Brady HJ, Verwijs-Janssen M, Van Den Berg JD,
Hart AA, Van Den Berg H, et al. The Bax alpha: Bcl-2 ratio
modulates the response to dexamethasone in leukaemic cells and
is highly variable in childhood acute leukaemia. Int J Cancer
1997; 71: 959_65.
|
