Extract
Note: Please read the complete
full text with Figures and Tables at
Introduction
The development of vascular tissues may be considered
in several different contexts. Vasculogenesis and
angiogenesis are 2 major processes responsible for the formation of
new blood vessels. Vasculogenesis refers to the
in situ formation of blood vessels from endothelial progenitor cells or
angioblasts[1]. In contrast, angiogenesis is a process
mediated through the sprouting of new capillaries from
pre-existing mature endothelial cells (EC). However, acute stress
injury of the vascular endothelium, such as hind-limb
ischemia or myocardial ischemia, leads to the loss of the
antithrombotic properties of the vessel wall and subsequently
leads to an increased number of circulating
EC[2]. Thus, regeneration of the vascular endothelium is of particular
importance in vascular repair. This endothelial reconstruction
can occur by migration and proliferation of surrounding
mature EC. However, mature EC are terminally differentiated
cells with a low proliferative potential, and their capacity to
repair damaged endothelium is limited. Therefore,
endothelial repair may need the support of other types of
cells[2]. Recent evidence show that the peripheral blood (PB) of adults
contains a unique subtype of circulating, bone
marrow-derived cells[3] with properties similar to those of embryonic
angioblasts[4]. These cells have the potential to proliferate
and to differentiate into mature EC and play an important
role in vascular repair. Therefore, they were termed
endo-thelial progenitor cells (EPC).
EPC populations can be grown from mononuclear cells
(MNC), purified populations of CD34-positive, or
CD133-positive hematopoietic cells[5,6]. In addition, CD14-positive
MNC have been used as the starting population for
cultivation of EPC[7]. Although there is convincing evidence for
the improvement of neovascularization by EPC
transplanta-tion, the origin of the endothelial progenitor lineage and its
characterization is not clear. EPC have been identified mainly
in whole mononuclear cell fractions of PB, leukapheresis
products[8,9], bone marrow, and umbilical cord blood
(UCB)[10,11]. Although most studies have been conducted with bone
marrow or PB-derived EC populations, only little is known
about the capacity of UCB-derived EPC. A recent study
suggests that UCB MNC-derived EPC have monocytic
characteristics and exhibit a unique functional activity to improve
neovascularization after hind-limb
ischemia[12]. All the groups that studied UCB-derived EPC, as well as group A, used
fresh UCB MNC; however, there are practical limitations in
the clinical application of EPC that use fresh UCB.
As the autologous or allogeneic hematopoietic stem cell
transplantation for the treatment of various diseases has
rapidly grown in recent years, the idea of UCB banking for
future use has drawn great interest. More than
100 000 units of UCB have been collected, frozen, and stored worldwide in
anticipation of their clinical use. Study in the potential of
cryopreserved UCB is of great importance for its future
clinical use, and we have attempted to enlarge the clinical
applications, especially in the angiogenesis field.
In this investigation, we induced the differentiation of
EPC from cryopreserved UCB-derived MNC using a simple
culture method and characterized them in terms of EPC marker
expression. Moreover, those cells were assessed in their
EPC potential in comparison with EPC from fresh PB-derived
MNC.
Materials and methods
UCB- and PB-derived MNC This project was approved
by the institutional review board (IRB) committee of Ajou
University, Suwon, Korea with signed consent from each
patient. Human UCB samples (60_120 mL) were collected
from a fresh umbilical cord attached to the placenta by
gravity flow in sterile blood bags containing CPDA-1 as an
anticoagulant. Human PB was collected from healthy
volunteers. MNC were isolated from the collected blood
using the Histopaque-density centrifugation method (Sigma,
St Louis, MO, USA). The collected MNC layers from UCB
were washed twice with phosphate buffer saline (PBS) and
cryopreserved in liquid nitrogen. PB-derived MNC were
directly differentiated EPC without the freezing step.
Cell culture The medium used for cell culture
experiments was Medium 199 (Life Technologies, Grand Island,
NY, USA) supplemented with 10% fetal bovine serum(FBS),
bovine pituitary extract as EC growth supplements (3 mg/L;
Sigma, USA) and 100 U/mL penicillin, and streptomycin (Life
Technologies, USA). 2×106 MNC from cryopreserved UCB
or PB were plated in 6-well trays pre-coated with human
fibronectin (Sigma, USA) and were incubated in a humidified
atmosphere at 37 °C with 5% CO2. The medium was changed
on d 3 after plating and every 3 d subsequently. Human
umbilical vein EC (HUVEC) were obtained from Dr Jung Keuk
PARK's laboratory, DongGuk University, Seoul, Korea, and
were cultured in EC basal medium-2 (EBM-2) (Clonetics,
Walkersville, MD, USA) supplemented with EGM-2 SingleQuots (Clonetics, Walkersville, MD, USA). HUVEC in
the passages between 3 and 6 were used in this study.
Freezing procedures The freezing of MNC was done as
previously described[13]. Separated MNC were put into
standard 1.8 mL cryotubes (Nalge Nunc, Rochester, NY, USA) at
4×107_6×107 cells per mL with a final concentration of 10%
DMSO (Sigma, USA) in autologous plasma while being
maintained at 4 °C. These samples were frozen in a controlled rate
freezer (Custom Biogenic System, Shelby Township, MI,
USA) and were further stored in liquid nitrogen (-196 °C)
until further use. UCB samples that had undergone
cryostorage for 0.2_5 years were used for the study.
Flow cytometric analysis Cryopreserved UCB- and
PB-derived MNC were induced to differentiate into endothelial
cells and were detached using 0.25% Trypsin-EDTA (Life
Technologies, USA) on d 7 and 14. They were subjected to
flow cytometric analysis in order to examine the surface
expression of CD31, CD34, CD105, CD45, CD133, and CD146.
The cells were labeled with 1 mg/L fluorescein isothiocyanate
(FITC)- or phycoerythrin (PE)-conjugated mouse anti-
human CD31-PE (Beckman Coulter, Paris, France),
CD34-FITC, CD45-FITC, CD146-PE (BD Sciences, Franklin Lakes,
NJ, USA), CD105-PE (Ancell, Bayport, MN, USA), and
CD133-PE (Miltenyi Biotec, Bergisch Gladbach, Germany)
monoclonal antibodies for 30 min at 4 °C in PBS. FITC- or
PE-conjugated mouse IgG were used as the control isotype
at the same concentration when the specific primary
antibodies were used. The fluorescence intensity of the cells
was evaluated by flow cytometry using a flow cytometer
(BD Sciences, Franklin Lakes, NJ, USA), and the data were
analyzed with CELLQUEST software (BD Sciences, USA).
RT-PCR Total RNA was prepared from cultured cells
using the TriZol Reagent (Life Technologies, USA). RNA
from HUVEC and MNC (before differentiation) was also
obtained. cDNA synthesis was performed with AMV Reverse Transcriptase XL (TaKaRa, Otsu, Japan), according
to the manufacturer's protocol. Two μg of the produced
DNA was amplified for 30 cycles using the following cycle
condition: 94 °C for 30 s, 56 °C for 1 min, and 72 °C for 1 min.
Human primers were: 5' GGTCTTACGGAGTATTGCTG 3' (forward) and 5' CTTTCTTTTGGGTCTCTGTG 3' (reverse)
for Flt-1/VEGFR-1; 5' GGACCTGGCGGCACGAAATA 3' (forward) and 5' AGGCCGGCTCTTTCGCTTAC 3' (reverse)
for kinase insert domain receptor (KDR)/VEGFR-2; 5'
AAGA-CATTTTCGGGCTCACGCTGCGCACCC 3' (forward) and 5'
TGGGGTAGGCACTTTAGTAGTTCTCCTAAC 3' (reverse) for ecNOS; 5' GATGCAGAGGCTCATGATGC 3' (forward)
and 5' CTTGCGACTCACGCTTGACT 3' (reverse) for VE-cadherin; 5' CACCGTTTGCCCACCCTTCG 3' (forward) and
5' GCCCACTGGGAGCCGACACT 3' (reverse) for von Willebrand factor
(vWF)[7]; and 5' TGAACCAGGCTTCAG-CATC 3' (forward) and 5' GGACTTCGAGCAAGATATGG 3'
(reverse) for β-actin. The amplified cDNA fragments were
electrophoresed through a 1% agarose gel and ethidium
bromide stained and then photographed under an ultraviolet
transilluminator (Core-Bio, Seoul, Korea).
Immunocytochemistry analysis Cells were cultured onto
fibronectin-coated, 2-chamber Lab-Tek slides (Nalge NUNC
International, Rochester, NY, USA) for 10 d. The cells were
fixed and sequentially incubated with primary antibodies
against vWF, KDR (Santa Cruz Biotechnology, Santa Cruz,
CA, USA), and VE-cadherin (Chemicon, Billerica, MA, USA),
and appropriated secondary antibodies. To detect
1,1'-dioctadecyl-3,3,3'-tet-ramethylidocarbocyanine-labeled
acetylated LDL (Dil-Ac-LDL) (Biomedical Technologies,
Stoughton, MA, USA) uptake, cells were incubated with 10
µg/mL Dil-Ac-LDL in fresh medium for 4 h and were fixed in
2% paraformaldehyde. The cells were stained with
FITC-labeled lectin from Ulex europaeus (UEA-1, Sigma, USA).
After being washed with PBS, the cells were stained with
1.5 µg/mL of 4',6-diamidino-2-phenylindole
dihydrochloride (DAPI, Sigma, USA). The slides were examined and
photographed under a fluorescent microscope (Olympus, Tokyo,
Japan).
Measurement of VEGF concentration To assess VEGF
secretion, cells were switched to growth factor-free basal
medium M199 with 10% FBS on d 10 for 72 h and then the
supernatant was harvested. VEGF concentration was
measured using an ELISA kit (R&D Systems, Minneapolis, MN,
USA).
EPC proliferation assay EPC proliferation after
differentiation was determined by MTT assay. After being
differentiated for 7 d, EPC were detached and cultured in M199
medium with 1% FBS and 30 μg/mL endothelial cell growth
supplement (ECGS) in a 96-well plate for 3_4 d. Then FBS
was added (to make a series of final concentrations: 10% and
20%) to investigate FBS effects on proliferation. The
medium with 1% FBS and 30 µg/mL ECGS served as the control.
After being cultured for 24 h, EPC were supplemented
with 1 g/L MTT and were incubated for another 2 h. Then
the supernatant was discarded by aspiration, and the EPC
preparation was shaken with 100 µL DMSO for 15 min. The
optical density was measured at 570 nm with the Thermo
Max (Molecular Devices, Sunnyvale, CA, USA).
Results
Morphological and immunophenotypical analysis of
differentiated EPC The viability of thawed UCB-derived MNC
was greater than 90% by trypan blue exclusion assay. When
cryopreserved UCB- and PB-derived MNC were cultured on
fibronectin-coated wells, a number of round-shaped cells
were loosely attached to the bottom after 24 h (Figure 1A,
1D), and numerous spindle-shaped cells began to appear
from the round-shaped ones on d 7 (Figure 1B, 1E).
Cord-like structures were observed on d 8 (Figure 1C, 1F), and
such structures were maintained until d 14.
Immunophenotypical analysis was performed on the cells
on d 0 (before differentiation), 7, and 14. We analyzed the
expression level of CD34 as an endothelial and
hematopoietic progenitor marker[13_15]; CD31, CD105, and CD146 as
markers for endothelial lineage; CD14 as a
monocyte/macrophage antigen; and CD45 as a common leukocyte antigen.
HUVEC were included as a positive control. Expression of
CD31 and CD105 on UCB-derived MNC was high, which we
reported recently[16], and increased after differentiation
(Figure 2). Perhaps UCB-derived MNC had the gene with
the potential to differentiate into EC. CD34 and CD146 did
not present on d 0, but they increased after differentiation.
Whereas HUVEC were fully differentiated cells, UCB-derived
MNC might need further development, leading to a rather
weak expression of CD146. Although CD146 expression
increased during the culture, it did not reach the expression
levels seen in HUVEC. EPC could still be at an early or
incomplete stage of differentiation. The expression level of
CD45 was strong before differentiation and did not decline
during the culture. We found that both cryopreserved
UCB-derived EPC and PB-derived EPC showed expression of
endothelial markers after differentiation. Additionally, their
expressed patterns did not reveal any striking differences.
RT-PCR analysis RT-PCR analysis was carried out for
Flt-1, KDR, ecNOS, VE-cadherin, and vWF. After a 7 d
culture in the differentiation medium, all the EC markers were
expressed in cryopreserved UCB-derived EPC (Figure 3). One
of the important functions of endothelial cells is to produce
nitric oxide (NO)[17], and this production is mediated by NO
syntheses (NOS). ecNOS expression in those cells suggests
that differentiated EPC (in this study, UCB-derived EPC), are
functional in terms of NO production. Additionally, Flt-1
was identified in UCB MNC before the previously-described
differentiation[7] and remained during the differentiation
process. Subsequently, PB-derived MNC did not express
any EC markers at all, and PB-derived EPC also showed the
same EC marker expression profiles as the UCB-derived EPC.
Immunocytochemistry of EPC Immunocytochemistry
analysis was performed to further characterize the
differentiated EPC. UCB-derived EPC were stained positive for KDR,
VE-cadherin, vWF, and UEA-1 on d 10 (Figure 4). In addition,
more than 90% of the spindle-shaped cells on d 7 took up
DiI-ac-LDL (Figure 4), one of the characteristics of
endothelial cells.
Secretion of VEGF by EPC The concentration of VEGF,
one of the well-known angiogenic cytokines, was measured
in the medium in which EPC were cultured. Both EPC from
UCB and PB secreted a comparable amount of VEGF (Figure
5) in the reports from the YB Park
group[18]. The basal medium M199 with 10% FBS did not contain measurable
amounts of VEGF.
EPC proliferation after differentiation To study the
proliferation potentiality of EPC, we performed a MTT assay
and compared the result from the UCB-derived EPC with that
from PB-derived EPC. The results were expressed as the
mean±SD of the relative value of control cells, which were in
the medium with 1% FBS+ECGS. Differentiated EPC from
both UCB and PB were positively proliferated as compared
with the controls (Figure 6).
Discussion
Various kinds of clinical trials are taking place using
numerous types of stem cell sources such as bone marrow,
peripheral blood and cord blood. More than 100 000 units of
cord blood that has been collected, frozen, and stored
worldwide in anticipation of their clinical use, are of great
importance for future clinics. However, there are many limitations
to using fresh cord blood for a clinical treatment of cord
blood. Many documents have already reported EPC
differentiation from fresh UCB[19_21]. When a growth factor
cocktail of high density such as VEGF, IGF, EGF, and FGF __
which is used for EPC differentiation using fresh UCB __ is
used for EPC differentiation using cryopreserved UCB, there
is a lower yield compared to EPC differentiation using fresh
UCB. Recently 20% FBS supplemented with crude bovine
pituitary extract as an EPC growth supplement was
used[11]. Therefore, we used both 20% and 10% FBS with crude
bovine pituitary extract as an EPC growth supplement and both
outcomes were similarly good, as seen in Figure 6. Thus, we
used 10% FBS supplemented with crude bovine pituitary
extract as an EPC growth supplement.
Depending on the time-dependent appearance, EPC can
be categorized as early EPC and late EPC, and they show
different morphology, proliferation rate, survival features,
and functions[22]. Although early EPC may be poor
in vitro functions, they may be good supporters for endothelial cells
forming new vessels[18]. These early EPC-like cells secreted
angiogenic cytokines such as VEGF, hepatocyte growth
factor (HGF), interleukin-8, and granulocyte-colony stimulating
factor (G-CSF), which might result in improved angiogenesis.
Therefore, we checked VEGF concentration as angiogenic
cytokines from cryopreserved UCB-derived EPC and were
able to get results. These cytokines might activate adjacent
endothelial cells and enhance angiogenesis. Additionally,
to assess the differentiation potential, we differentiated
through the method mentioned above, from PB-derived MNC
and fresh UCB-derived MNC. Cryopreserved UCB-, fresh
UCB-, and PB-derived EPC expressed all the EC markers, and
stained positive for KDR, VE-cadherin, vWF, and UEA-1
(data not shown). The results of proliferation and secretion
of VEGF were also similar. Moreover, we suggested that
cryopreserved UCB-derived EPC have identical
differentiation potential with the fresh UCB- and PB-derived EPC.
In this report, we investigated the in
vitro differentiation of EPC using cryopreserved UCB-derived MNC in order to
establish a culture system for EPC. To confirm the EPC
characteristics, we used the previously-reported EC markers.
Cell surface molecules such as CD34, KDR, Tie-2/Tek, CD146,
and VE-cadherin are known to be expressed by EC at the
early stage of vasculogenesis[23_25]. Flt-1, one of the
receptors for VEGF, is a marker expressed on primitive angioblasts
during vasculogenesis in embryogenesis, as well as on EC
during tumor angiogenesis in adults[25]. vWF, expressed on
mature endothelium and platelets, has been well utilized to
identify EC[23]. Despite the large number of molecules
reported in vasculogenesis/angiogenesis, there has been no
exclusive marker for EPC yet[26]. We observed
that cryopreserved, UCB-derived EPC expressed all the makers
of endothelial cells using the RT-PCR analysis. In a flow
cytometric analysis, these cells were strongly positive for
CD31 and CD105, and expressed CD146 that is found on
circulating EPC[22], but at a low level. Although CD146
expression increased during the culture, it did not reach the
expression levels seen in HUVEC. The CD34 that was present
on endothelial progenitors and hematopoietic progeni-
tors[6,13,15] was not present on undifferentiated MNC, but was
expressed after differentiation. Most mature endothelial cells,
except for microvascular endothelial cells, no longer express
CD34[27]. The EPC that were differentiated with the culture
method that we have established could still be at an early or
incomplete stage of differentiation. The surface marker expression that was reported by the Rehman
group[28] and their angiogenic effects are most likely mediated by growth
factor secretion.
It was reported that expression of CD14 and CD45 on
undifferentiated UCB MNC decreases over time, but remains
strong after differentiation until 28 d. In the case of
CD34+ culture-dish-non-adherent cells, expression of CD45 and
CD14 decreased, while CD34 and the progenitor cell marker
CD133 remained strong. In CD34+ culture-dish-adherent
cells, however, CD14 decreased, and CD45 did not
change[19]. From our results, CD45 and CD14 remained strong until d 14 as
seen in Figure 2 and gradually decreased afterwards until d
28 after differentiation, which was similar to the result of
unselected MNC.
We were able to produce EPC through the method
mentioned above, which is a simpler culture method for a short
period of time. It has been widely reported through
in vivo tests that those cultured EC can be used for clinical trials of
ischemic diseases[14,15]. However, the amount of cells that
can be obtained through the culture is not sufficient for a
clinical application. The previous
method[10] uses fresh bone
marrow[27], peripheral
blood[18], and cord
blood[20], while we successfully cultured the cells kept at -196 °C, frozen from
UCB-derived MNC, into cells with the quality of EPC. We
also obtained the same results when we used stored MNC in
-196 °C for a long period of time. The clinical trials using
cord blood will significantly increase in the future due to the
clinical importance of cord blood. Our method enhances the
utility of cord blood banking for a differentiation of
endothelial cells as well as a clinical application. Our results also
suggest that cryopreserved UCB can be used as a potential
source of endothelial cells for cellular angiogenic
therapies.
References
1 Rosenzweig A. Endothelial progenitor cells. N Engl J Med 2003;
348: 581_2.
2 Hristov M, Erl W, Weber PC. Endothelial progenitor cells:
mobilization, differentiation, and homing. Arterioscler Thromb
Vasc Biol 2003; 23: 1185_9.
3 Harraz M, Jiao C, Hanlon HD, Hartley RS, Schatteman GC. CD34-
blood-derived human endothelial cell progenitors. Stem Cells
2001; 19: 304_12.
4 Kamihata H, Matsubara H, Nishiue T, Fujiyama S, Tsutsumi
Y, Ozono R, et al. Implantation of bone marrow
mononuclear cells into ischemic myocardium enhances collateral perfusion and
regional function via side supply of angioblasts, angiogenic ligands,
and cytokines. Circulation 2001; 104: 1046_52.
5 Arras M, Ito WD, Scholz D, Winkler B, Schaper J, Schaper W.
Monocyte activation in angiogenesis and collateral growth in
the rabbit hindlimb. J Clin Invest 1998; 101: 40_50.
6 Asahara T, Murohara T, Sullivan A, Silver M, van der Zee R, Li
T, et al. Isolation of putative progenitor endothelial cells for
angiogenesis. Science 1997; 275: 964_7.
7 Fernandez Pujol B, Lucibello FC, Gehling UM, Lindemann K,
Weidner N, Zuzarte ML, et al. Endothelial-like cells derived
from human CD14 positive monocytes. Differentiation 2000;
65: 287_300.
8 Gehling UM, Ergun S, Schumacher U, Wagener C, Pantel K, Otte
M, et al. In vitro differentiation of endothelial cells from
AC133-positive progenitor cells. Blood 2000; 95: 3106_12.
9 Gill M, Dias S, Hattori K, Rivera ML, Hicklin D, Witte L,
et al. Vascular trauma induces rapid but transient mobilization of
VEGFR2(+)AC133(+) endothelial precursor cells. Circ Res 2001;
88: 167_74.
10 Murohara T. Therapeutic vasculogenesis using human cord
blood-derived endothelial progenitors. Trends Cardiovasc Med 2001;
11: 303_7.
11 Murohara T, Ikeda H, Duan J, Shintani S, Sasaki K, Eguchi H,
et al. Transplanted cord blood-derived endothelial precursor cells
augment postnatal neovascularization. J Clin Invest 2000; 105:
1527_36.
12 Urbich C, Heeschen C, Aicher A, Dernbach E, Zeiher AM, Dimmeler
S. Relevance of monocytic features for neovascularization
capacity of circulating endothelial progenitor
cells. Circulation 2003; 108: 2511_6.
13 Peichev M, Naiyer AJ, Pereira D, Zhu Z, Lane WJ, Williams M,
et al. Expression of VEGFR-2 and AC133 by circulating human
CD34(+) cells identifies a population of functional endothelial
precursors. Blood 2000; 95: 952_8.
14 Pesce M, Orlandi A, Iachininoto MG, Straino S, Torella AR,
Rizzuti V, et al. Myoendothelial differentiation of human
umbilical cord blood-derived stem cells in ischemic limb tissues. Circ
Res 2003; 93: e51_62.
15 Rafii S, Shapiro F, Rimarachin J, Nachman RL, Ferris B, Weksler
B, et al. Isolation and characterization of human bone marrow
microvascular endothelial cells: hematopoietic progenitor cell
adhesion. Blood 1994; 84: 10_9.
16 Lee MW, Choi J, Yang MS, Moon YJ, Park JS, Kim HC,
et al. Mesenchymal stem cells from cryopreserved human umbilical
cord blood. Biochem Biophys Res Commun 2004; 320: 273_8.
17 Bompais H, Chagraoui J, Canron X, Crisan M, Liu XH, Anjo A,
et al. Human endothelial cells derived from circulating progenitors
display specific functional properties compared with mature
vessel wall endothelial cells. Blood 2004; 103: 2577_84.
18 Hur J, Yoon CH, Kim HS, Choi JH, Kang HJ, Hwang
KK, et al. Characterization of two types of endothelial progenitor cells and
their different contributions to neovasculogenesis. Arterioscler
Thromb Vasc Biol 2004; 24: 288_93.
19 Eggermann J, Kliche S, Jarmy G, Hoffmann K, Mayr-Beyrle U,
Debatin KM, et al. Endothelial progenitor cell culture and
differentiation in vitro: a methodological comparison using human
umbilical cord blood. Cardiovasc Res 2003; 58: 478_86.
20 Fan CL, Li Y, Gao PJ, Liu JJ, Zhang XJ, Zhu DL. Differentiation
of endothelial progenitor cells from human umbilical cord blood
CD 34+ cells in vitro. Acta Pharmacol Sin 2003; 24: 212_8.
21 Kim SY, Park SY, Kim JM, Kim JW, Kim MY, Yang JH,
et al. Differentiation of endothelial cells from human umbilical cord
blood AC133-CD14+ cells. Ann Hematol 2005; 84: 417_22.
22 Lin Y, Weisdorf DJ, Solovey A, Hebbel RP. Origins of circulating
endothelial cells and endothelial outgrowth from blood. J Clin
Invest 2000; 105: 71_7.
23 Eichmann A, Corbel C, Nataf V, Vaigot P, Breant C, Le Douarin
NM. Ligand-dependent development of the endothelial and
hemopoietic lineages from embryonic mesodermal cells expressing
vascular endothelial growth factor receptor 2. Proc Natl Acad
Sci USA 1997; 94: 5141_6.
24 Nishikawa SI, Nishikawa S, Hirashima M, Matsuyoshi N, Kodama
H. Progressive lineage analysis by cell sorting and culture
identifies FLK1+VE-cadherin+ cells at a diverging point of endothelial
and hemopoietic lineages. Development 1998; 125: 1747_57.
25 Yamaguchi TP, Dumont DJ, Conlon RA, Breitman ML, Rossant
J. flk-1, an flt-related receptor tyrosine kinase is an early marker
for endothelial cell precursors. Development 1993; 118: 489_98.
26 Rafii S. Circulating endothelial precursors: mystery, reality, and
promise. J Clin Invest 2000; 105: 17_9.
27 Reyes M, Dudek A, Jahagirdar B, Koodie L, Marker PH, Verfaillie
CM. Origin of endothelial progenitors in human postnatal bone
marrow. J Clin Invest 2002; 109: 337_46.
28 Rehman J, Li J, Orschell CM, March KL. Peripheral blood
"endothelial progenitor cells" are derived from
monocyte/macrophages and secrete angiogenic growth factors. Circulation 2003;
107: 1164_9.
|
