Extract
Note: Please read the complete
full text with Figures and Tables at
Introduction
Cluster of differentiation(CD) 71, human transferrin
receptor, is abundantly expressed in rapidly dividing cells as
well as on many tumor cells, which makes CD71 a relatively
specific marker of these cells[1]. Laboratory investigations
and clinical studies have demonstrated that anti-CD71 mAb
or CD71 binding factors have antiproliferative effects on
CD71-positive cells by blocking the engagement of
transferrin with its receptor and interfering in the intake of iron into
cell[2,3].
However, murine mAb can induce the production of
human antimouse antibodies when administered repeatedly
in the human body, which may render the antibody
ineffective and may also harm
patients[4]. Furthermore, the administered murine mAb could not bind to the Fc receptor expressed
on human phagocytes, natural killer cells, B cells
etc. There-fore, murine mAb could not exert opsonization and
phagocytosis effects and could not mediate antibody-dependent,
cell-mediated cytotoxicity[5]. Hence, murine mAb showed no
effective suppression on lymphoproliferation in
vivo and had limited effect on lessening transplantation rejection,
which would restrain their further applications in clinic
practice[6]. At present, efforts have been directed at the
engineering of antibodies to improve their utility, lessen unwanted
effects, and alter the effector functions through the
modification of Ig genes by using recombinant expression
techniques[7]. The chimeric human/murine antibody containing
murine V regions combined with human C regions retained
the ability of mAb to recognize specific antigen, but had low
antigenicity to humans[8].
In the present study, starting with a previously
established hybridoma 7579 producing a monoclonal antibody to
CD71, we prepared the chimeric human/murine anti-CD71
mAb (AbCD71), confirmed its biological characteristics, and
exploited its effect on lymphoproliferation.
Materials and methods
Plasmid construction and transfection Total RNA
prepared from the anti-CD71 mAb-secreting hybridoma cell line
7579 (preserved by our laboratory) was reverse-transcripted
into cDNA. Then PCR was performed using the following
primers: variable domain of light
chain(VL) sense P1:5'-GGGGTCGACCTCACCAT
GGATTTTCAAGTGCAGATTTTCAG-3'; VL antisense
P2:5'-GGCCTGCGGCCGC TTTAAATTCTACTCACGTTTGATTTCCAGCTTGGT-3';
variable domain of heavy chain(VH) sense P1:5'-
GGGGTCGACCTCACCATGGAATGCAGCTGTGTAATC CTCTT-3'; and
VH antisense P2:5'-GGCCTGCGGCCGCAGTAGAGCAGACTCA
CCTGAGGAGACAGTGACC-3'. After being digested with
Sal I and Not I the VL and
VH PCR products were subcloned into pκ-Expr and
pγ-Expr vectors (preserved by our labora-tory), respectively. Following linearization by
Pvu I, Chi7579_pκ-Expr and Chi7579_pγ-Expr were cotransfected into
immunoglobulin non-producing mouse myeloma cell line
SP2/0-Ag14 by electroporation (Gene pulser transfection
apparatus 165-2078 Bio-Rad, Richmond, CA, USA). G418 (500
µg/mL, Promega, Madison, WI, USA)-resistant clones were
analyzed for the following assays.
ELISA The sandwich ELISA was used to determine the
expression of AbCD71 in the transfectoma supernatant. The
plate was coated with 10 µg/mL goat antihuman
immunoglobulin G (IgG, γ chain specific, Sigma, St Louis, MO, USA).
The secondary antibody was 1:800 diluted mouse
antihuman κ chain mAb (Sigma, USA). 1:1000 diluted horseradish
peroxidase (HRP)-conjugated goat antimouse IgG (Kirkegaard
Perry Labs Inc, Gaithersburg MD, USA) served as the third
antibody. After exposure to the HRP substrate (Pierce,
Rockford, IL, USA), optical density (OD) values were read at
a 490 nm wavelength.
Indirect immunofluorescence assay The
antigen-binding characteristic of AbCD71 was measured by indirect
immunofluorescence assay. CD71-positive CEM cells were
cocultured with original murine anti-CD71 mAb hybridoma
supernatant at different dilutions (undiluted, 1:10, 1:20, 1:40,
and 1:80) or PBS. Then the transfectoma supernatant was
added. After goat antihuman IgG_fluorescent isothiocyanate
(FITC) (BD Biosciences, San Diego, CA, USA) was
supple-mented, the percentage of the FITC-positive cells was
evaluated by FACSCalibur flow cytometer (BD Biosciences, USA).
This methodology was also used to analyze the
percentage of CD71-expressed PBMC activated by
phytohemagglutinin (PHA). After being isolated by Ficoll_Hypaque density
centrifugation, the PBMC were cocultured with PHA (final
concentration, 25 µg/mL; Sigma, USA). At different
time-points (12, 36, and 60 h) after activation, the cells were
collected in order to analyze the CD71 expression by flow
cyto-meter (FCM).
Preparation and purification of antibodies
The transfectoma was intraperitoneally inoculated into Balb/c
(nu/nu) nude mice to induce the ascites for the preparation of
AbCD71. Hybridoma 7579 was inoculated into Balb/c mice
to induce the ascites for the preparation of anti-CD71 mAb.
The antibodies were purified from the ascites via
diethyl-aminoethyl (DEAE)-Sephadex A-50 chromatography
(Pharmacia, Piscataway, NJ, USA). Then the purified
antibody was identified by SDS_PAGE and indirectly elevated
in the immunofluorescence assay as mentioned before.
Inhibitory effect of AbCD71 on PHA-induced PBMC
proliferation The PBMC were cocultured with PHA at a final
concentration of 0 and 25 µg/mL, respectively, and AbCD71
or murine anti-CD71 mAb (final concentration, 1, 10, and 100
µg/mL, respectively) for 5 d. Then PBMC proliferation was
measured by methyl thiazolyl tetrazolium(MTT) method. The
untreated PBMC group was set as negative control and the
isotype antibody-treated group was set as another negative
control. The PBMC group, induced with 25 µg/mL PHA, but
untreated with antibodies, was set as the positive control.
Triplicates were set for each group. After reading the OD
values (A) at 570 nm, the inhibitory rates were calculated
as the following formula: the inhibitory rate (%) of cell
proliferation=(1_[the mean A of the experimental
group/the mean A of the positive control group])×100.
In another experiment, at different time-points after PHA
stimulation (0, 12, 36, and 60 h), AbCD71 or murine anti-CD71
mAb (final concentration, 0, 1, 10, and 100 µg/mL,
respec-tively) was supplemented into the PBMC culture system.
After 5 d of culture, the MTT assay was performed with the
same controls as before. Then the inhibitory rates were
calculated.
Statistical analysis The t-test was performed to compare
the inhibitory rates. Differences were regarded as
statistically significant when P<0.05.
Results
Confirmation of AbCD71 constant domains After G418
screening, the cells in the 4 wells showed transfectoma cells
growth (numbered as C1_4).
The mean OD values of the 4 G418-resistant clones were
higher than those of the blank control and the negative
control (Table 1). The results indicated that the heavy chain of
AbCD71 in the transfectoma supernatant could bind to goat
antihuman IgG (γ specific) and its light chain could bind to
mouse antihuman κ chain mAb.
AbCD71 competed with its parental murine mAb to bind
to CD71-positive CEM cells It was confirmed that AbCD71
contained human IgG heavy chain and light chain constant
domains. Did AbCD71 still remain the murine variable
domain and retain antigen-binding specificity? Indirect
immunofluorescence assays showed that as the concentration of
the hybridoma supernatant decreased from undiluted to a
dilution of 1:80, the percentage of FITC-positive cells
increased from 15.16%±0.73% to 56.22%±2.65%. When the
CEM cells were precultured with PBS, the percentage rose to
71.49%±3.60% (Figure 1). These figures suggested that the
less the murine mAb combined with CD71 molecules, the
more AbCD71 bound to the CEM cells, hence an increase in
the CEM cells emitting green fluorescence.
Identification of purified AbCD71 by SDS_PAGE
After the transfectoma clone secreting AbCD71 was
identified, the clone cells were inoculated into mice and the
resultant ascites fluid was used to prepare purified AbCD71.
The yield was about 4_8 mg of the antibody in 3_5 mL of the
ascites. SDS_PAGE displayed 2 specific protein bands with
molecular weights of about 55 and 25 kDa, which
presumably represented the heavy chain and light chain of AbCD71,
respectively (Figure 2). The purity of the antibody was more
than 95%. The specificity of purified AbCD71 was identified
by indirect immunofluorescence assay. The same results (data
not shown) were obtained as those of the transfectoma
supernatant.
AbCD71 could inhibit PHA-induced
lymphoprolifera-tion Data showed that AbCD71 could inhibit PHA-induced
lymphocyte proliferation obviously (Figure 3A). When the
concentration of the antibody varied between 1_100 µg/mL,
the inhibitory rate increased as the concentration of AbCD71
rose. There was no statistical difference in the inhibitory
rates between AbCD71 and original murine anti-CD71 mAb
at the corresponding concentrations (P>0.05).
The PBMC failed to proliferate in the absent of PHA.
Hence, AbCD71 or the murine antibody showed no effect on
PBMC proliferation (inhibitory rate <1%).
It was demonstrated that when AbCD71 and PHA were
added together, proliferation of resting lymphocytes could
be inhibited by AbCD71. It remained unclear whether
stimulated lymphocyte proliferation could be suppressed. For that
reason, first, the percentage of activated PMBC, on which
membrane CD71 expression was upregulated, was measured.
We found that 38.6%±1.91%, 89.6%±4.38%, and
90.8%±4.12% PBMC were activated and expressed CD71 on their
membranes after 12, 36, and 60 h of PHA stimulation, respectively
(Figure 3B). Second, following stimulation for 12, 36, and 60
h, the PBMC were incubated with AbCD71. The results showed
that AbCD71 inhibited proliferation of induced PBMC in a
dose-dependent manner when the concentration of the
antibody varied between 1 and 100 µg/mL. Proliferations were
suppressed strongly at the time-points of 0 and 12 h. PBMC
proliferation at 60 h was not evidently inhibited. There were
statistical differences (P<0.01) between the groups treated
with the same concentration, but induced for different time
periods (Figure 3C). All these data showed no statistical
difference (P>0.05) when compared with the corresponding
concentration of murine mAb-treated groups.
Discussion
In the present study, the light chain gene and the heavy
chain gene of AbCD71 were constructed into 2 expression
vectors, respectively. Only when those 2 vectors were
cotransfected into the same recipient cell could an intact
antibody be produced. Using ELISA, the coated goat
antihuman IgG γ could be combined when the transfectoma
supernatant contained the human IgG heavy chain.
Sub-sequently, the mouse antihuman Ig κ was supplemented.
After exposure to the substrate, only those wells containing
intact human IgG (κ specific) could be developed into yellow.
Hence, the species specificity of AbCD71 constant regions
was confirmed. The following indirect immunofluorescence
assay demonstrated that the chimeric Ab could compete with
their original murine mAb to bind to the target antigen. This
means that AbCD71 retained the affinity and
antigen-binding specificity of its parental murine mAb. The above 2
assays verified that AbCD71 not only reserved the variable
region of its original murine mAb, but also possessed of the
constant region of human IgG.
CD71 expression is essential for continued growth and is
closely linked to the proliferative status of a cell. In addition,
the CD71 molecule is recognized as a lymphocyte activation
marker[9,10]. Therefore, CD71 may be a potential therapeutic
target for transplantation rejection. After the biological
characteristics of AbCD71 were identified, its antiproliferative
effect on human PBMC was investigated. PBMC could
proliferate and express CD71 on their membranes when induced
by mitogen[11], which could mimic post-transplantation
lymphoproliferative responses. Our experiment also verified
that the expression of CD71 on PBMC increased in response
to 25 µg/mL PHA stimulation. After exposure to PHA for 36
h, most PBMC were activated and proliferated efficiently
because the percentage of CD71-expressed PBMC showed no
evident alteration in the following hours.
A subsequent inhibitory rate analysis suggested that the
administration of AbCD71 at the time of PHA stimulation
could strongly inhibit proliferation and clonal expansion of
PBMC in vitro. In evaluating the optimal timing of AbCD71
addition to the culture medium, we could see that there was
a distinct inhibition when AbCD71 was added at 0 and 12 h
after PHA induction, compared with 36 and 60 h timepoints.
AbCD71 administration at the early stage of mitogen
presentation was more effective than at the time of maximal
receptor expression, suggesting an early role for AbCD71
in antirejection. The possible explanation is that AbCD71
exerts growth suppression by blocking the CD71 molecules
distributed on PBMC, and thus blocking iron uptake in
activated lymphocytes. Cellular iron is crucial for cell
survival[1,12]. At the early stage of mitogen stimulation, PBMC needed
iron for continued growth and proliferation. CD71 blockade
at this period resulted in the lack of sufficient iron availability.
Hence, PBMC proliferated poorly in response to mitogen
stimulation[13]. At the late stage, when PBMC already
underwent clonal expansion, their particular needs for high levels
of iron ceased. CD71 blockade and iron starvation at this
time would have had a limited effect on the total PBMC
number. Hence, the inhibitory rate at 36 h decreased and the
data reached nadir at 60 h. Future studies will improve our
understanding of AbCD71 in the activation of lymphocytes
and will provide the knowledge necessary for utilizing
AbCD71 blockade as a novel therapeutic strategy for
clinical transplantation.
The above data manifested that AbCD71 could
specifically bind to the CD71 molecules expressed on the
membranes of activated lymphocytes and could inhibit the
lymphoproliferation. It seems that AbCD71 administration
would lower the incidence of transplantation rejection and
not produce human antimouse antibodies. Thus, the use of
AbCD71 may result in more effective immunosuppression in
transplantation. AbCD71 looks to be a promising
immuno-suppressant. Our approach to blocking the transferrin
receptor using chimeric human/murine mAb provides a novel
strategy for prolonging allograft survival.
References
1 Daniels TR, Delgado T, Rodriguez JA, Helguera G, Penichet ML.
The transferrin receptor part I: biology and targeting with
cytotoxic antibodies for the treatment of cancer. Clin Immunol 2006;
121: 144_58.
2 White S, Taetle R, Seligman PA, Rutherford M, Trowbridge IS.
Combinations of anti-transferrin receptor monoclonal
antibodies inhibit human tumor cell growth in
vitro and in vivo: evidence for synergistic antiproliferative effects. Cancer Res 1990; 50:
6295_301.
3 Kreitman RJ, Pastan I. Recombinant toxins containing human
granulocyte-macrophage colony-stimulating factor and either
pseudomonas exotoxin or diphtheria toxin kill gastrointestinal
cancer and leukemia cells. Blood 1997; 90: 252_9.
4 Mirick GR, Bradt BM, Denardo SJ, Denardo GL. A review of
human anti-globulin antibody (HAGA, HAMA, HACA, HAHA)
responses to monoclonal antibodies. Not four letter words. Q J
Nucl Med Mol Imaging 2004; 48: 251_7.
5 Presta LG. Engineering of therapeutic antibodies to minimize
immunogenicity and optimize function. Adv Drug Deliv Rev 2006;
58: 640_56.
6 Klee GG. Human anti-mouse antibodies. Arch Pathol Lab Med
2000;124: 921_3.
7 Gonzales NR, De Pascalis R, Schlom J, Kashmiri SV. Minimizing
the immunogenicity of antibodies for clinical application.
Tumour Biol 2005; 26: 31_43.
8 Hwang WY, Foote J. Immunogenicity of engineered antibodies.
Methods 2005; 36: 3_10.
9 Woodward JE, Bayer AL, Chavin KD, Boleza KA, Baliga P.
Anti-transferrin receptor monoclonal antibody: a novel
immuno-suppressant. Transplantation 1998; 65: 6_9.
10 Jason J, Archibald LK, Nwanyanwu OC, Bell M, Jensen RJ, Gunter
E, et al. The effects of iron deficiency on lymphocyte cytokine
production and activation: preservation of hepatic iron but not
at all cost. Clin Exp Immunol 2001; 126: 466_73.
11 Lio D, Candore G, Cigna D, D'Anna C, Di Lorenzo G, Giordano
C, et al. In vitro T cell activation in elderly individuals: failure in
CD69 and CD71 expression. Mech Ageing Dev 1996; 89: 51_8.
12 Daniels TR, Delgado T, Helguera G, Penichet ML. The
transferrin receptor part II: targeted delivery of therapeutic agents into
cancer cells. Clin Immunol 2006; 121: 159_76.
13 Keyna U, Nusslein I, Rohwer P, Kalden JR, Manger B. The role
of the transferrin receptor for the activation of human
lym-phocytes. Cell Immunol 1991; 132: 411_22.
|
