Extract
Note: Please read the complete
full text with Figures and Tables at
post-transcriptional gene-silencing process that has been
proposed as a potential treatment for
cancer[1]. Specific gene silencing can be achieved in a variety of cell systems using
chemically synthesized siRNA or DNA vector-based
shRNA[2,3]. A few promoters have been used to drive shRNA
expression in cells, including the U6 and H1 RNA polymerase
III promoters, and the cytomegalovirus (CMV) RNA
polymerase II promoter.
However, the use of these promoters to drive shRNA
expression in vivo would silence a given gene in all cell types,
and thus produce undesirable effects in non-target cells.
Cell-specific targeting of siRNA is an important issue to
consider in RNAi therapy[4]. Before RNAi can be used to treat
metastatic cancers, however, good cellular targets must be
found[5]. To silence a gene specifically in tumor cells,
without affecting its expression in normal cells, a tumor-
specific promoter has to be used. To date, there are no
reports of a tumor-specific promoter to drive shRNA
expres-sion. Recently, cell-specific gene silencing has been
achieved by using cell-specific promoters (SP-C) to drive
shRNA expression, and a loxP-CRE regulatable RNAi
system has also been developed[6,7].
In the present study, we attempted to develop a
tumor-specific RNAi system directly under the control of the hTERT
promoter. We investigated whether this system could
depress the expression of exogenous reporter genes, firefly
luciferase (LUC) and enhanced fluorescent protein
(EGFP) and an endogenous gene (Bcl-2). We constructed
corresponding vectors containing various shRNAs driven by
hTERT promoters. Using these vectors, we demonstrated
efficient silencing of target genes specific to tumor cells, but
not in normal cell in vitro. We also established HeLa cells
stably expressing shRNA to target Bcl-2, which could
increase the chemosensitivity of cells to 5-fluorouracil.
Materials and methods
Plasmid construction To construct an hTERT
promoter-driven shRNA vector (pBlock-TRTP-shRNA-mpA), the
hTERT promoter, including 413 bp upstream from the
transcription initiation site, was cloned from pGL3B-TRTP (a kind
gift from Dr Mary CUSTER, National Cancer Institute,
Bethesda, MD, USA) by polymerase chain reaction (PCR)
and inserted into pSilencer4.1 (Ambion, USA) to replace the
CMV promoter. A minimal poly(A) sequence (5¡¯-TTATTTCC
TAGAAAATAAAAGTAACCTAGACACACAACCAAA
AAACATACGCCGGCGA-3¡¯) was used as a terminal sequ-ence. The DNA oligonucleotides coding for the shRNA were
inserted between BamH1 and HindIII restriction sites.
shRNAs targeting LUC, EGFP,
Bcl-2, and an unrelated shRNA negative control (control) were synthesized: shLUC,
sense 5¡¯-GATCCCTTACGCTGAGTACTTCGATT CAAGA-GATCGAAGTACTCAGCGTAAGTTA-3¡¯, antisense
5¡¯-AGCTTAACTTACGCTGAGTACTTCGATCTCTTGAATCGAA-TACTCAGCGTAAG-3¡¯; shEGFP, sense
5¡¯-GATCCCACAA-GCTGGAGTACAACTACTTCAAGAGAGTAGTTGTACTCCA-
GCTTGTGTTA-3¡¯, antisense 5¡¯-AGCTTAACACAAGCT-GGAGTACAACTACTCTCTTGAAGTAGTTGTACTCCA-
GCTTGTGG-3¡¯; shBcl-2, sense
5¡¯-GATCCGTACATCCATTA-TAAGCTGTTTCAAGAGAACAGCTTATAATGGATGTA-
CTT-3¡¯, antisense 5¡¯-AGCTTAAGTACATCCATTATAA-GCTGTTCTCTTGA AACAGCTTATAATGGATGTACG-3¡¯;
shControl, sense 5¡¯-ATCCACTACCGTTGTTATAGGTG-TTCAAGAGAC ACCTATAACAACGGTAGTA-3¡¯, antisense
5¡¯-AGCTTACTACCGTTGTTATAGGTGTCTCTTGAACA-CCTATAACAACGGTAGTG-3¡¯. The target sequences were
selected based on published synthetic siRNA
sequences[6,8,9]. To facilitate the analysis of shRNA efficacy, an sv40-driven
luciferase-expressing cassette from pGL3-promoter was
separately inserted into pBlock-TRTP-shLUC-mpA and
pBlock-TRTP-shControl-mpA between SalI and
NotI restriction sites. The CMV-driven EGFP-expressing cassette from
pGL3-CMV-EGFP (constructed with a framework of pGL3-promoter, with
the CMV promoter from pCDNA3.0 replacing the sv40
promoter between BglII and HindIII restriction sites, and the
EGFP gene from pEFGP-N1 replacing the luciferase gene
between HindIII and XbaI restriction sites) was separately
inserted into pBlock-TRTP-shEGFP-mpA and
pBlock-TRTP-shControl-mpA between SalI and
NotI restriction sites. The method used was similar to the one described by Zeng
et al[10].
Cell culture and transfection HeLa, HepG2, and A549
cells were grown in Dulbecco¡¯s modified Eagle¡¯s medium
(DMEM) supplemented with 10% bovine calf serum (BCS),
100 U/mL penicillin and 100 mg/mL streptomycin. WI-38 cells
were grown in DMEM medium supplemented with 10% fetal
bovine serum (FBS), 100 U/mL penicillin and 100 mg/mL
streptomycin. The cells were transfected in opti-MEM with
the transfection reagent Lipofectamine-2000 (Invitrogen,
USA) according to the manufacturer¡¯s instructions. To
establish HeLa cells stably expressing shRNA, cells were
treated with 2 µg/mL puromycin (Sigma, USA) for 14 d, and
after that cells continued to be cultured with 1 µg/mL
puro-mycin.
Luciferase assay HeLa, HepG2, A549 and WI-38 cells
were transfected in 24-well culture plates with 0.8
mg firefly
luciferase (Fr-luc)-expressing vectors
(pBlock-TRTP-shLUC-mpA-sv40-luciferase or
pBlock-TRTP-shControl-mpA-sv40-luciferase) and 0.01
mg Renilla luciferase (Re-luc)-expressing vector (pRL-sv40) as transfection controls. The cells were
harvested 48 h after transfection. The luciferase activity
was measured with a dual luciferase assay kit (Promega, USA)
using a luminometer (Lumat LB 9506, Berthold Technology).
The relative luciferase activity was defined as the ratio of
Fr-luc activity to Re-luc activity.
Reverse transcription polymerase chain reaction
analysis After being treated with DNase, 2 µg of total RNA was
reverse-transcribed into cDNA using M-MLV reverse
transcriptase (Invitrogen, USA) in the presence of random
primers. The cDNA was used to amplify the
EGFP or Bcl-2 fragments. For normalization of RNA loading, the
housekeeping gene b-actin was also amplified from each sample.
The primer sequences were as follows: EGFP, sense
5¡¯-TGCCACCTACGGCAAGCTGA-3¡¯, antisense 5¡¯-TCGA-TGTTGTGGCGGATCTT-3¡¯;
Bcl-2, sense 5¡¯-CGACGA-CTTCTCCCGCCGCTACCGC-3¡¯, antisense
5¡¯-CCGCATGC-TGGGGCCGTACAGTTCC-3¡¯; b-actin, sense 5¡¯-CCAAGG
CCAACCGCGAGAAGATGAC-3¡¯, antisense 5¡¯-AGGGTA-CATGGTGGTGCCGCCAGAC-3¡¯. PCR amplification was
performed using the following conditions: 1 cycle of
95 °C for 5 min; for EGFP 25 cycles of 95 °C for 30 s, 56 °C for 30 s, 72 °C
for 30 s; for Bcl-2, 30 cycles of 95
°C for 30 s, 60 °C for 30 s,
72 °C for 30 s; followed by a final elongation step of 72 °C for
10 min. After amplification, 10 µL of PCR product was run on
a 1.5% agarose gel and visualized by ethidium bromide
staining.
Fluorescence-activated cell sorting
analysis HepG2, HeLa, A549, and WI-38 cells were transfected in 6-well
culture plates with pBlock-TRTP-shEGFP-mpA-CMV-EGFP or
pBlock-TRTP-shControl-mpA-CMV-EGFP. Forty-eight hours after transfection, the cells were photographed by
using a fluorescence microscope and then harvested. Half
of the cells were used to extract total RNA for reverse
transcription (RT)-PCR, the others to observe the levels of
EGFP fluorescence using fluorescence-activated cell sorting
(FACS; calibur, BD, USA).
The cell cycle distribution profile was analyzed by FACS.
A total of 1×106 cells were collected and washed with
phosphate-buffered saline (PBS), fixed in ice-cold 70% ethanol
and stored at 4 °C. After being resuspended in PBS
containing 100 mg/mL RNase A and 20 mg/mL
propidium iodide (PI) for 30 min, samples were analyzed by FACS.
MTT assay The
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H
-tetrazolium bromide (MTT) assay was performed to assess the effect of
Bcl-2 on cell proliferation and chemosen
sitivity to 5-fluorouracil. Cells were plated in 96-well plates
at a density of 5×103
cells per well. Then for 7 d, every 24 h a
batch of cells were stained with 20 µL sterile MTT dye (5
mg/mL; Sigma, USA) at 37 °C for 4 h, then culture medium
was removed and 150 µL of Me2SO was added and
thoroughly mixed in for 10 min. Spectrometric absorbance at 570
nm was measured by using a microplate reader. Each group
contained 4 wells. To assess chemosensitivity to
5-fluoro-uracil, cells cultured for 24 h were incubated with different
concentrations of 5-fluorouracil for another 48 h. Then cells
were treated with MTT as described earlier. The cell
survival value index was calculated as
[A570(5-fluorouracil+)/
A570(5-fluorouracil_)]×100%.
Western blotting Cells were lysed in RIPA buffer [1%
NP-40, 0.1% sodium dodecylsulfate (SDS), 0.5% deoxycholic
acid (DOC), 150 mmol/L NaCl, 10 mmol/L Tris-HCl, and
phenylmethylsulfonyl fluoride(PMSF)] at 4 °C for 30 min.
An equal volume of lysate was electrophoresed with
SDS-polyacrylamide gel electrophoresis (PAGE;
12%). The separated proteins in the gel were transferred to the
nitrocellulose membrane. The membranes were blocked with
Tris-buffered saline plus 0.1% Tween-20 (TTBS) containing 5%
non-fat milk for 1 h, incubated with the appropriate primary
antibodies [anti Bcl-2 (Santa Cruz, USA);
anti-b-actin (Sigma)] in TTBS containing 5% non-fat milk for 2 h, followed by
incubation with secondary antibodies for 1 h. Finally, the
proteins were visualized by enhanced chemiluminescence
reagents (Pierce, USA) and the specific bands were recorded
on X-ray film.
Statistical analysis All experiments were performed in
triplicate. Student¡¯s t-test was used to determine the
statistical significance of the data obtained.
P<0.05 was taken to represent a statistically significant difference between means.
Results
Construction of shRNA-expressing vectors with hTERT
promoter We constructed an hTERT promoter-driven
shRNA-expressing vector (pBlock-TRTP-shRNA-mpA). The shRNAs targeting
LUC, EGFP, Bcl-2 and negative
control were separately cloned into pBlock-TRTP-shRNA-mpA,
and the corresponding plasmids were named
pBlock-TRTP-shLUC-mpA, pBlock-TRTP-shEGFP-mpA,
pBlock-TRTP-shBcl-2-mpA and pBlock-TRTP-shControl-mpA,
respec-tively. All constructs were sequence-verified.
Effect of shRNA on exogenous reporter
expression We first tested whether hTERT promoter-driven shLUC could
inhibit the expression of firefly luciferase. To facilitate the
analysis of shRNA efficacy, we constructed the pBlock-TRTP-
shLUC-mpA-SV40-luciferase (pBshLUC, Figure 1A) and
pBlock-TRTP-shControl-mpA-SV40-luciferase (pBLUC) vectors. Cells were transfected with the Fr-luc-expressing
vectors (pBshLUC or pBLUC) and the Re-luc-expressing
vector pRL-sv40. Luciferase activity was determined by a
dual luciferase assay 48 h after transfection. The relative
luciferase activity was defined as the ratio of Fr-luc activity
to Re-luc activity. The mean pBshLUC/pBLUC ratios were
0.327±0.070, 0.308±0.063 and 0.426±0.034 in HeLa, HepG2
and A549 tumor cells, respectively (P<0.01
vs control; Figure 1B), whereas the mean
pBshLUC/pBLUC ratio was 0.880±
0.172 in WI-38 cells.
Next we investigated the inhibitory effects of hTERT
promoter-driven shRNA targeted to another exogenous reporter,
EGFP. We also constructed
pBlock-TRTP-shEGFP-mpA-cmv-EGFP (pBshEGFP; Figure 2A) and
pBlock-TRTP-shControl-mpA-cmv-EGFP (pBEGFP) vectors. The
concentration of EGFP transcripts was determined by RT-PCR,
normalized to the concentration of b-actin mRNA. We found
that the concentration of EGFP transcripts decreased in
HepG2, HeLa and A549 cells transfected with pBshEGFP,
relative to controls, whereas there was no change in WI-38
normal cells (Figure 2B).
The inhibitory effects of shEGFP on EGFP protein were
evaluated by fluorescence microscopy and FACS. The
relative level of EGFP fluorescence did not change in WI-38
cells, but dropped markedly in HepG2, HeLa and A549 cells
transfected with pBshEGFP, as determined by direct
visualization under a fluorescence microscope (Figure 2C) and
FACS analysis (P<0.01; Figure 2D). The results were
consistent with those at the mRNA level.
Effect of shRNA on Bcl-2
expression We next tested whether the shRNA controlled by the hTERT promoter worked
on the endogenous gene Bcl-2. HeLa cells were transfected
with pBlock-TRTP-shBcl-2-mpA (pBshBcl-2) or
pBlock-TRTP-shControl-mpA (pBControl). For establishing HeLa
cells stably expressing shRNA, cells were treated with 2
µg/mL puromycin for 14 d, and after that cells continued to
be cultured with 1 µg/mL puromycin. The level of
Bcl-2 expression did not change in HeLa cells stably transfected
with pBControl relative to that in untransfected cells (data
not shown), but was markedly reduced in cells stably
transfected with pBshBcl-2, as evaluated by RT-PCR and Western
blotting (Figure 3A, 3B).
Effect of Bcl-2 expression on proliferation and cell cycle
The proliferation rates of HeLa cells stably expressing
shBcl-2 and shControl were similar, as determined by MTT
chronometry (Figure 4). We also used FACS to analyze the cell
cycle distribution profile. Inhibition of Bcl-2
did not influ
ence the cell cycle profile (data not shown), suggesting that
the Bcl-2 gene did not significantly affect cell growth or
viability.
Effect of Bcl-2 expression on chemosensitivity to
5-fluorouracil Because the Bcl-2 gene has been found to play an
important role in resistance to chemotherapy in many tumors,
we next investigated if inhibition of Bcl-2 by RNAi affected
the sensitivity of HeLa cells to the anti-tumor drug
5-fluorouracil. The survival index in HeLa cells stably
expressing shBcl-2 was markedly reduced with the addition of 100
µg/mL or 200 µg/mL 5-fluorouracil (0.225±0.020
vs 0.359±
0.039, 0.125±0.019 vs 0.228± 0.040;
P<0.05, Figure 5) relative to controls.
Discussion
Utilization of a promoter that is predominantly active in
tumor cells would be an ideal strategy for restricting
therapeutic gene expression. Telomerase is a particularly
attractive target because approximately 90% of tumor cells have
telomerase activity, whereas most normal cells do not
express that enzyme. In human cells, telomerase is under the
transcriptional control of the hTERT gene, whose product is
the catalytic subunit of the enzyme[16]. Transcriptional
activity of the hTERT promoter is highly specific to
telomerase-positive tumor cells. Therefore, the hTERT promoter has
been widely used in targeting cancer gene therapy to restrict
the expression of exogenous genes to various cancer
cells[12_14]. A recent report also showed that the hTERT
promoter might be a good, safe candidate for gene
therapy[15]. To determine whether the hTERT promoter can be used to
produce shRNA and silence gene expression in a
tumor-specific fashion, we constructed a vector in which shRNA in the
form of a small hairpin structure was placed under the
control of the 403 bp hTERT promoter followed by a minimal
polyA (mpA) sequence. A similar mpA has been used
successfully for CMV and SP-C promoter-driven
shRNA[6,11].
In the present study, we demonstrated that hTERT
promoter-driven shRNA could depress the expression of the
exogenous reporter genes (firefly luciferase and
EGFP) in different tumor cells (HeLa, HepG2 and A549) but not normal
cells (WI-38). WI-38 cells are human fetal lung fibroblasts,
which have no endogenous hTERT
expression[16], and are often used as representative normal
cells[17,18]. hTERT promoter-driven shLUC decreased luciferase expression by
approximately 70% according to the dual luciferase assay. The
efficacy was similar to that of chemically synthesized siRNA
or other DNA vector-based shRNA targeted to
luciferase[8]. shEGFP driven by the hTERT promoter depressed the mRNA
and protein expression of EGFP to the same level. This
reveals that shRNA synthesized by the hTERT promoter
silences gene expression in a sequence-specific manner
through targeting mRNA for endonucleolitic cleavage.
We next tested whether the hTERT promoter-driven
shRNA worked on the endogenous gene Bcl-2.
Bcl-2 is an apoptotic inhibitor that may contribute to therapeutic
resistance. It is the first oncogene found to function through
production of an inhibitor of programmed cell
death[19]. Overexpression of
Bcl-2 is common in many human cancers, and contributes to increased resistance to
chemotherapy[20_22]. Bcl-2 antisense oligonucleotides can increase the
anticancer drug sensitivity of tumor
cells[23,24]. Recently, successful attempts were made to silence
Bcl-2 using RNAi
techniques[9,25]. RNAi techniques have been repeatedly proven to be more
robust than antisense techniques because they work more
often, typically decrease expression of a gene to lower level,
and also act at concentrations below those required for
antisense techniques[25]. Therefore, antisense strategies may
be replaced by RNAi approaches. Our study showed that
shBcl-2 driven by the hTERT promoter could depress the
expression of Bcl-2 with respect to both mRNA and protein
levels. Suppression of Bcl-2 did not influence cell growth,
but increased chemosensitivity to 5-fluorouracil in HeLa cells.
Our results regarding the significant biological effects of
tumor-specific RNAi against the Bcl-2 gene might be
considered promising for future RNAi-based therapeutic
approaches in HeLa cells or other malignant cell types. Using
this strategy, some oncogenes could also be depressed in
tumor cells without interfering with other cell systems.
In conclusion, we report here the first tumor-specific RNAi
system using the hTERT promoter. We demonstrated that
hTERT promoter-driven shRNA expression could effectively
and specifically silence gene expression in different tumor
cells but not in normal cells in vitro. We also showed that
inhibition of Bcl-2 expression with this system could increase
chemosensitivity to 5-fluorouracil in HeLa cells. This
system might be a good candidate for future RNAi therapy.
References
References
1 Wall NR, Shi Y. Small RNA: can RNA interference be exploited
for therapy? Lancet 2003; 362: 1401_3.
2 Sui G, Soohoo C, Affar el B, Gay F, Shi Y, Forrester WC,
et al. A DNA vector-based RNAi technology to suppress gene expression
in mammalian cells. Proc Natl Acad Sci USA 2002; 99: 5515_20.
3 Brummelkamp TR, Bernards R, Agami R. A system for stable
expression of short interfering RNAs in mammalian cells.
Science 2002; 296: 550_3.
4 Robinson R. RNAi therapeutics: how likely, how soon? PLoS
Biol 2004; 2: E28.
5 Hannon GJ, Rossi JJ. Unlocking the potential of the human
genome with RNA interference. Nature 2004; 431: 371_8.
6 Gou D, Narasaraju T, Chintagari NR, Jin N, Wang P, Liu L. Gene
silencing in alveolar type II cells using cell-specific promoter
in vitro and in vivo. Nucleic Acids Res 2004; 32: e134.
7 Tiscornia G, Tergaonkar V, Galimi F, Verma IM. CRE
recombinase-inducible RNA interference mediated by lentiviral
vectors. Proc Natl Acad Sci USA 2004; 101: 7347_51.
8 Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl
T. Duplexes of 21-nucleotide RNAs mediate RNA interference
in cultured mammalian cells. Nature 2001; 411: 494_8.
9 Cioca D, Aoki Y, Kiyosawa K. RNA interference is a functional
pathway with therapeutic potential in human myeloid leukemia
cell lines. Cancer Gene Ther 2003; 10: 125_33
10 Zeng Y, Yi R, Cullen BR. MicroRNAs and small interfering
RNAs can inhibit mRNA expression by similar mechanisms. Proc
Natl Acad Sci USA 2003; 100: 9779_84.
11 Xia H, Mao Q, Paulson HL, Davidson BL. siRNA-mediated gene
silencing in vitro and in vivo. Nat Biotechnol 2002; 20: 1006_10.
12 Komata T, Kanzawa T, Kondo Y, Kondo S. Telomerase as a
therapeutic target for malignant gliomas. Oncogene 2002; 21:
656_63.
13 Jacob D, Davis JJ, Zhang L, Zhu H, Teraishi F, Fang B.
Suppression of pancreatic tumor growth in the liver by systemic
administration of the TRAIL gene driven by the hTERT promoter.
Cancer Gene Ther 2005; 12: 109_15
14 Song JS, Kim HP, Yoon WS, Lee KW, Kim MH, Kim KT
et al. Adenovirus-mediated suicide gene therapy using the human
telomerase catalytic subunit (hTERT) gene promoter induced
apoptosis of ovarian cancer cell line. Biosci Biotechnol Biochem
2003; 67: 2344_50.
15 Groot-Wassink T, Aboagye EO, Wang Y, Lemoine NR, Keith
WN, Vassaux G. Noninvasive imaging of the transcriptional
activities of human telomerase promoter fragments in mice.
Cancer Res 2004; 64: 4906_11.
16 Casillas MA, Brotherton SL, Andrews LG, Ruppert JM, Tollefsbol
TO. Induction of endogenous telomerase (hTERT) by c-Myc in
WI-38 fibroblasts transformed with specific genetic elements.
Gene 2003; 316: 57_65.
17 Seo E, Abei M, Wakayama M, Fukuda K, Ugai H, Murata T, et al.
Effective gene therapy of biliary tract cancers by a conditionally
replicative adenovirus expressing uracil phosphoribosyltransferase:
significance of timing of 5-fluorouracil administration. Cancer
Res 2005; 65: 546_52.
18 Kuo PL, Hsu YL, Lin TC, Lin CC. The antiproliferative activity
of prodelphinidin B-2 3'-O-gallate from green tea leaf is through
cell cycle arrest and Fas-mediated apoptotic pathway in A549
cells. Food Chem Toxicol 2005; 43: 315_23.
19 Gross A, McDonnell JM, Korsmeyer SJ. BCL-2 family members
and the mitochondria in apoptosis. Genes Dev 1999; 13:
1899_911.
20 Nicolson NL, Talpaz M, Nicolson GL. Chromatin nucleoprotein
complexes containing tightly bound c-abl, p53 and bcl-2 gene
sequences: correlation with progression of chronic myelogenous
leukemia. Gene 1996; 169: 173_8.
21 Sarac S, Akyol MU, Kanbur B, Poyraz A, Akyol G, Yilmaz T,
et al. Bcl-2 and LMP1 expression in nasopharyngeal carcinomas.
Am J Otolaryngol 2001; 22: 377_82.
22 Khabir A, Ghorbel A, Daoud J, Frikha M, Drira MM, Laplanche
A, et al. Similar BCL-X but different BCL-2 levels in the age
groups of North African nasopharyngeal carcinomas. Cancer
Detect Prev 2003; 27: 250_5.
23 Lopes de Menezes DE, Hu Y, Mayer LC. Combined treatment of
Bcl-2 antisense oligodeoxynucleotides (G3139),
p-glycoprotein inhibitor (PSC833), and sterically stabilized liposomal
doxorubicin suppresses growth of drug resistant growth of drug-resistant
breast cancer in severely combined immunodeficient mice. J
Exp Ther Oncol 2003; 3: 72_82.
24 Rudin CM, Kozloff M, Hoffman PC, Edelman MJ, Karnauskas R,
Tomek R, et al. Phase I study of G3139, a bcl-2 antisense
oligonucleotide, combined with carboplatin and etoposide in
patients with small-cell lung cancer. J Clin Oncol 2004; 22:
1110_7.
25 Lima RT, Martins LM, Guimaraes JE, Sambade C, Vasconcelos
MH. Specific downregulation of bcl-2 and xIAP by RNAi
enhances the effects of chemotherapeutic agents in MCF-7 human
breast cancer cells. Cancer Gene Ther 2004; 11: 309_16.
|
