Wang HL et al / Acta Pharmacol Sin 2004 Jun; 25 (6): 738-743

Dispersion of ventricular mRNA of RyR2 and SERCA2 associated with arrhythmogenesis in rats1

Hong-lan WANG, De-zai DAI 2, Feng GAO3, Yan-pin ZHANG3, Feng LU

Research Division of Pharmacology, China Pharmaceutical University, Nanjing 210009, China;
3Laboratorial Center of Medicine, Southeast University, Nanjing 210009, China

1 Supported by Key Project from the National Natural Science Foundation of China, No 30230170.

2 Correspondence to Prof De-zai DAI. Phn 86-25-8327-1270. Fax 86-25-8330-2827. E-mail dezaidai@vip.sina.com

Received 2003-11-17 Accepted 2004-04-08

KEY WORDS myocardial infarction; isoproterenol; arrhythmia; calcium; 4-chlorobenzyltetrahydroberberine

ABSTRACT

AIM: To investigate the effect of CPU86017 on the changes of mRNA abundance of different calcium handling system in infarcted heart. METHODS: Rats were subjected to left coronary ligation to induce myocardial infarction (MI). The treatment with either propranolol (Pro) 5 mg/kg ip or CPU86017 1, 2, and 4 mg/kg ip was initiated on the next day of operation and continued for 20 d. Medication with isoproterenol (Isop) 3 mg/kg sc started on the d 17-21. Ventricular mRNA abundance of ryanodine receptor 2 (RyR2), sarcoplasmic reticulum Ca2+-ATPase (SERCA2), L-type Ca2+ channel, and Na+/Ca2+exchanger (NCX1) were measured. RESULTS: Arrhythmic scores (AS) in the Isop group was raised up to 5.27±1.75 (P<0.01) vs myocardial infarction group 2.25±2.04 and sham group 1.50±1.73. The AS was depressed by Pro (1.63±1.53, P<0.01 vs Isop), and CPU86017 2 and 4 mg/kg (3.00±1.24, and 1.70±1.85, P<0.01 vs Isop). The significant dispersion of depressed mRNA abundance of RyR2 and SERCA2 was associated with an increase in AS in Isop group, and it was much depressed in the left than the right ventricle. The dispersion and depression of mRNA were restored significantly by Pro and CPU86017, associated with suppression on AS. In Isop group, the mRNA abundance of L-type Ca2+ channel was not changed; and a moderate increase in the mRNA of NCX1 was seen, the changes were regressed by Pro and CPU86017. CONCLUSION: Isop-induced arrhythmogenesis in MI heart was correlated mainly with a dispersion of depressed mRNA abundance in ventricle likely due to the consequence of PKA over-phosphorylation. A suppression of arrhythmia by Pro and CPU86017 resulted from a regression of the dispersion and depression of RyR2 and SERCA2.

INTRODUCTION

Severe ventricular arrhythmias are remained great risk of mortality in patients with cardiovascular disorders and cover about 50 % of the death[1,2]. The progression of heart failure is developed by abnormality of the calcium handling system in myocardium[3,4]. However, it is still uncertain whether the abnormality is involved in the pathological derangement of enhancing severity of cardiac arrhythmias. Phosphorylated sarcoplasmic reticulum (SR) ryanodine receptor 2 (RyR2) and SR Ca2+- ATPase (SERCA2) are activated to release or up-take calcium from the SR. On the other hand, in case of a failing heart an over-phosphorylation of the two has been focused and is attributed to an access of PKA activated by the pathological process of cardiac failure[5-7]. On the stimulation of b-adrenergic receptors (bARs) by exposure to isoproterenol (Isop), it is interesting to observe and compare whether arrhythmo-genesis is induced and what is the most prominent change of the mRNA abundance among RyR2, SERCA2, L-type Ca2+ channel, and Na+/Ca2+exchanger (NCX1) in an infarcted heart. Since the dispersion of the function among ion channels of IKr, IKs, IKI, ICa.L, and Ito has been found in remodeled heart by L-thyroxin, and this shows a tendency of exacerbated arrhythmias on ischemia/reperfusion[3,8-10], so it is reasonable to consider that exaggerated cardiac arrhythmia can be the result of the dispersion of the intracellular ion channels on the SR.

The ion channelopathy contributing to arrhythmo-genesis could be considered in two different categories, the basic and activated ion channelopathy[1,9]. The basic phase of ion channelopathy in an infarcted myocardium has no tendency to enhance cardiac arrhythmias on episode of ischemia/reperfusion. A more serious ion channelopathy of an affected myocardium shows a tendency of enhancing cardiac arrhythmias after ischemia/reperfusion of coronary artery and a disordered intracellular calcium handling system is involved. It is evidenced in L-thyroxin induced remodeling that multi-channels are disordered in the lipid membrane in association of abnormal calcium dealing system in an affected heart[3,10-12]. Therefore, we intended to investigate whether there existed dispersion of mRNA abundance of different intracellular calcium dealing system, and effects of propranolol (Pro) and CPU86017.

MATERIALS AND METHODS

Drugs Isop (Shanghai Harvest Pharmaceutics Co, Ltd); Pro (Sigma); CPU 86017 (purity>99 %; Department of Pharmaceutical Chemistry, China Pharmaceutical University)

Study protocol Myocardial infarction (MI) was induced by permanent ligation of the left anterior coronary artery using a standardized surgical procedure. Male Sprague-Dawley rats (203±16 g; Center of Experimental Animals, China Pharmaceutical University) were anesthetized with diethylether. Then rats were artificially ventilated with room air. Electrocardiogran (ECG) was monitored. The heart was exposed, and a 5-0 silk suture was placed around the left coronary artery (2-3 mm from its origin), then the suture was tied securely. In rats that underwent sham surgery, suture was through underneath the coronary artery without ligation.

Twenty-four hours after surgery , the survival rats were divided randomly into 6 groups: (1) MI; (2) Isop (MI rats by administration of 3 mg/kg Isop sc on d 17-21 after MI); (3) Pro (3 mg/kg Isop sc on d 17-21 after MI; Pro treatment started at 24 h after MI, ip, 5 mg/kg for 20 d); (4)-(6)CPU 86017 1, 2 , and 4 mg/kg (3 mg/kg Isop sc on d 17-21 after MI; CPU 86017 treatment started at 24 h after MI, ip, for 20 d). Sham surgical rats were served as sham group.

Ischemia-reperfusion arrhythmia The rats were anesthetized with pentobarbitone (50 mg/kg, ip) and heparin (1000 U/kg, ip). The heart was excised rapidly and perfused via the aorta in the Langendorff mode with Tyrode's solution (37 ºC) saturated with 95 % O2 and 5 % CO2. Perfusion pressure was maintained at 47.8 mmHg. Three 0.1-mm silver electrodes were placed in the left ventricle, right atrium, and aorta to record ECG throughout the experimental period. The heart was initially given a 15-min aerobic perfusion; ischemia was produced by reducing the perfusion flow to one tenth for 10 min; then the perfusion flow was resumed for 20 min (reperfusion). Arrhythmia score (AS) was evaluated according to previous study[13].

RNA preparation Total RNA was isolated from 100 mg frozen right and left ventricular muscle tissue by using 1 mL Trizol (BBI). The amount of total RNA was determined spectrophtometrically (Gene Ltd) at a wavelength of 260 nm, and the RNA was stored at -80 ºC for reverse transcription-polymerase chain reaction (RT-PCR).

Semi-quantitative RT-PCR A quantity of 0.4 µg RNA was reacted in a 25 µL mixture containing 1×reaction buffer, MgSO4 1 mmol/L, 200 µmol/L of each dNTP, specific primer 1 µmol/L, 2.5 U AMV reverse transcriptase, and 2.5 U TfI DNA polymerase. This mixture was overlaid with 20 µL mineral oil. After an incubation for 45 min at 45 ºC to initiate the synthesis of cDNAs, the reverse transcription was inactivated at 94 ºC for 2 min. PCR was performed with the following conditions: denaturing at 94 ºC for 30 s, annealing at 60 ºC for 1 min, extension at 68 ºC for 2 min, 40 cycling, and final extension at 68 ºC for 7 min (BIO-RAD Gene CyclerTM). The specific primers were as follows (Sangon): RyR2 sense 5´-GAATCAGTGAGTTACTGG-GCATGG-3´ and antisense 5´-CTGGTCTCTGAGT-TCTCCAAAAGC-3´ (635 bp)[5]; SERCA2 sense 5´-ATGAGATCACAGCTA-TGACTGGTG-3´ and antisense 5´-GACTTGCACA-TCTCTATGGTGACTAG-3´ (638 bp)[14]; NCX1 sense TCTTCAGAAGTCTCGGAAGAT and antisense CACTTCCAGCTTGGTGTGT (644 bp)[15]; L-type Ca2+ channel sense 5´-ATCCCCAAGAACCA-GCACCAG-3´ and antisense 5´-GGTGATGGAGATGC-GGGAGTT-3´ (372 bp)[16]. To ensure a fixed amount of initial mRNA paralleled b-actin amplification was performed using the following oligonucleotides: sense 5´-GGTATGGGTCA-GAAGGACTCC-3´ and antisense 5´-TGATCTTCA-TGGTGCTGCTAGGAGCC-3´ (780 bp).

The amplification products were separated by agarose gel electrophoresis (1.5 %), stained with ethidium-bromide, and visualized under ultraviolet, and scanned by Magemaster VDS (Pharmacia Biotech). The density of the bands was analyzed by computer with Laboratory Work 4.0 (Protein scan systems, Gene Ltd). The relative density of bands for each mRNA was divided by the band for the internal control b-actin. Sham and MI groups: n=8; Isop, Pro, and CPU 86017 groups: n=9.

Statistical analysis All data were presented as mean±SD. Difference between groups were evaluated by analysis of variance (ANOVA) followed by t-test. Statistical significance was accepted at level of P<0.05.

RESULTS

Survival rate of rats and weight index of the heart There was no death in the sham-operated rats. Three weeks after surgery, the survival rate was calculated for each group (Tab 1). In Isop group, the survival rate decreased markedly. The survival rate was increased after treatment with Pro and CPU86017 (2 and 4 mg/kg). In MI and Isop group, heart weight index, right ventricle (RV) weight index, and left ventricle (LV) weight index were increased significantly. It indicated that ventricular hypertrophy occurred. Pro and CPU86017 (4 mg/kg) could regress the hypertrophy induced by MI and Isop (Tab 2).

Tab 1. The survival rate for each group.

Groups

Survival number

Survival rate/%

Sham

10/10

100

MI

12/13

92.3

Isop

9/17

52.9

Pro

11/13

84.6

CPU86017/mg¡¤kg-1

 

 

1

8/15

53.3

2

10/15

66.7

4

10/13

76.9

Tab 2. Comparison among heart weight index (HWI), right ventricle weight index (RWI), and left ventricle weight index (LWI, myocardial weight dividing by body weight). Mean±SD. cP<0.01 vs sham group. eP<0.05, fP<0.01 vs Isop group.

Groups

Weight index/mg¡¤g-1

 

HWI

RWI

LWI

Sham (n=10)

3.82¡À0.41

0.61¡À0.10

2.95¡À0.35

MI (n=12)

4.65¡À0.57c

1.19¡À0.36c

3.25¡À0.29f

Isop (n=9)

5.04¡À0.46c

1.16¡À0.09c

3.78¡À0.46c

Pro (n=11)

4.43¡À0.23f

0.88¡À0.25f

3.31¡À0.14f

 

 

 

 

CPU86017/mg¡¤kg-1            

 

 

 

1 (n=8)

5.06¡À0.62

1.20¡À0.45

3.80¡À0.52

2 (n=10)

5.02¡À0.17

1.12¡À0.14

3.88¡À0.18

4 (n=10)

4.38¡À0.22f

0.91¡À0.18f

3.29¡À0.32e

Ischemia-reperfusion arrhythmia Compared with sham group, there was no significant difference in MI group. In Isop group, AS increased markedly. Pro and CPU86017 (2 and 4 mg/kg) improved the arrhythmia (Tab 3).

Tab 3. Score of arrhythmia induced by an ischemia-reperfu-sion in isolated rat hearts. Mean±SD. cP<0.01 vs sham group. fP<0.01 vs Isop group.

Groups

Score

Sham (n=10)

1.50¡À1.73

MI (n=12)

2.25¡À2.04f

Isop (n=9)

5.27¡À1.75c

Pro (n=11)

1.63¡À1.53f

 

 

CPU86017/mg¡¤kg-1

 

1 (n=8)

5.30¡À1.65

2 (n=10)

3.00¡À1.24f

4 (n=10)

1.70¡À1.85 f

Change of mRNA expression of Ca2+ handling system There was no significant difference in mRNA expression of Ca2+ handling system in MI group compared with that of sham group. In Isop group, mRNA expression changed markedly. The mRNA abundance of RyR2 and SERCA2 were decreased by 83.6 % and 77.6 % respectively in LV, and decreased by 36.7 % and 38.1 % in RV, respectively (P<0.01 vs MI). But the mRNA abundance of NCX1 were increased by 63.8 % in LV, and 40.4 % in RV (P<0.01 vs MI). There was significant difference in mRNA expression of RyR2 and SERCA2 between LV and RV in Isop group (P< 0.01), and it was more depressed in the LV against the RV indicating dispersion between two sides of ventricle. The mRNA abundance of L-type Ca2+ channel had no significant difference. After the treatment with Pro and CPU86017 (2 and 4 mg/kg), the abundance of mRNA was normalized and the difference between LV and RV disappeared (Fig 1-4).

Fig 1. The mRNA expression levels of RyR2 by RT-PCR. n=9-12. Mean±SD. cP<0.01 vs sham group. eP<0.05, fP<0.01 vs Isop group. iP<0.01 compared between LV and RV.

Fig 2. The mRNA expression levels of SERCA2 by RT-PCR. n=9-12. Mean±SD. cP<0.01 vs sham group. eP<0.05, fP<0.01 vs Isop group. iP<0.01 compared between LV and RV.

Fig 3. The mRNA expression levels of L-type calcium channel by RT-PCR. Mean±SD.

Fig 4. The mRNA expression levels of NCX1 by RT-PCR. Mean±SD. cP<0.01 vs sham group. eP<0.05, fP<0.01 vs Isop group. iP<0.01 compared between LV and RV.

DISCUSSION

In post-MI rats continuously received Isop resulted in a b ARs overactivation to mimic the hypersympathetic overactivity which was likely related to develop of ion channelopathy and heart failure[17-20]. The AS after hypoxia/reperfusion was not increased in the MI group, however, it was raised after medication with Isop associated with a significant ventricular hypertrophy. It was implied that an involvement of bARs activation was prominent to promote the appearance of exaggerated cardiac arrhythmias. We observed that Pro was effective to suppress the arrhythmias markedly together with a reduction in the myocardial hypertrophy. CPU 86017, which is derived from tetrahydroberberine not only had mild b-blockade, potent a-blockade effects[ 21], but also had blockade on multi-channels including the L-type Ca2+ channel[22]. The severity of cardiac arrhythmias developed by hypoxia/reperfusion was exaggerated significantly by an addition of a b-agonist and an a-agonist[23]. A blockade on the a-receptor was likely to play a role in the antiarrhythmic mechanism of CPU86017. The medication of Isop created a series of oxygen free radicals by the oxidation of the catechol-amine, and oxidative stress was reconsidered as a primary factor in morbidity of cardiac failure. The anti- oxidative effect of CPU86017 and Pro[24] was well impressed, so it contributed to reduce the incidence of cardiac arrhythmias on ischemia/reperfusion episode.

The depressed mRNA abundance of RyR2 and SERCA2 was evident and these were coincided in hypertrophied myocardium[5,7]. A phenomena of "leaky" caused an increased Ca2+ during the diastolic phase but a reduced Ca2+ release in the systolic phase[25]. It was very interesting to find that the reduction in mRNA abundance of the RyR2 and SERCA2 in the right and left ventricle was different significantly, with the more depressed RyR2 and SERCA2 on the left side. This phenomenon of dispersion indicated that the imbalance of Ca2+ ion in the cytosol of myocytes was more serious in the LV; therefore, it offered a tendency of arrhythmo-genesis and enhancement of arrhythmias on hypoxia/reperfusion episode, and it was likely to be equal important with the dispersion of the ion channels in membrane[3,8-10].

The over-phosphorylation by PKA was considered as an important factor causing a depression of RyR2 and SERCA2, so, it might be deduced that the extent of the phosphorylation on the two ventricles was different; an over-dispersed-phosphorylation of the calcium handling system existed in the MI heart stimulated by Isop, this offered a status prone to the occurrence of severe cardiac arrhythmias. Intervention of Pro and CPU86017 resulted in a suppression of arrhythmia associated with a recovery of the dispersion of RyR2 and SERCA2 in the two ventricles, particular in the improvement on the left side.

There were likely two different types of phosphorylation of RyR2 and SERCA2 by PKA. The up-regulation of the RyR2 and SERCA2 was possibly characterized by an increment of calcium released intracellularly in the cardiac remodeling by L-thyroxin[12]. When an infarcted heart was medicated with Isop, RyR2 was hyperphosphorylated by PKA in failure hearts[4].

The L-type Ca2+ channel was not involved in the development of the cardiac arrhythmias in this model and the NCX1 might play a minor role in this respect. The selectivity of the impairment of the calcium handling system in an infarcted heart delivered information properly that the RyR2 and SERCA2 were the most important elements in the pathogenesis of cardiac arrhythmias and cardiac dysfunction.

The dispersion of the intracellular calcium channels among the RyR2, SERCA2, and NCX1 served as a basis of arrhythmogenesis. By the intervention with Pro and CPU86017, the dispersion was recovered in a dose-response manner and associated with improvement of hypertrophy and arrhythmias.

REFERENCES