Zhang YJ et al / Acta Pharmacol Sin 2004 Oct; 25 (10): 1341-1346

Montelukast modulates lung CysLT₁ receptor expression and eosinophilic inflammation in asthmatic mice¹

Yan-jun ZHANG^2,3, Lei ZHANG², Shao-bin WANG⁴, Hua-hao SHEN⁴, Er-qing WEI^2,5

²Department of Pharmacology, Zhejiang University School of Medicine, Hangzhou 310031;
³Zhejiang Provincial Centre for Disease Control and Prevention, Hangzhou 310009; ⁴Department of Respiratory Diseases, The Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou 310009, China

¹ Project supported by the National Natural Science Foundation of China, No 30271498.

⁵ Correspondence to Prof Er-qing WEI. Phn/Fax 86-571-8721-7391. E-mail weieq2001@yahoo.com

Received 2003-09-04 Accepted 2004-01-07

KEY WORDS leukotriene receptors; leukotriene antagonists; asthma; inflammation; montelukast

ABSTRACT

AIM: To determine the expressions of cysteinyl leukotriene receptors, CysLT₁ and CysLT₂, in airway eosinophilic inflammation of OVA-induced asthmatic mice and the modulation by montelukast, a CysLT₁ receptor antagonist. METHODS: Asthma model was induced by chronic exposure to ovalbumin (OVA) in C57BL/6 mice. The eosinophils in bronchoalveolar lavage (BAL) fluid and lung tissues were counted, IL-5 level in BAL fluid was measured, and CysLT₁ and CysLT₂ receptor mRNA expressions were detected by semi-quantitative RT-PCR. Results: Montelukast (6 mg/kg, once per day for 20 d) significantly suppressed the increased eosinophils in BAL fluid and lung tissue, and increased IL-5 level in BAL fluid in OVA challenged mice. OVA challenge increased CysLT₁ but decreased CysLT₂ receptor mRNA expression. Montelukast inhibited the increased CysLT₁ but not the reduced CysLT₂ expression after OVA challenge. CONCLUSION: CysLT receptors are modulated immunologically, and montelukast inhibits up-regulation of CysLT₁ receptor and airway eosinophilic inflammation in asthmatic mice.

INTRODUCTION

Cysteinyl leukotrienes (CysLTs, including LTC₄, LTD₄, and LTE₄) are important inflammatory mediators, which are produced predominantly by eosinophils, mast cells, and macrophages in response to a variety of stimuli activating arachidonate 5-lipoxygenase pathway^[1]. CysLT₁ selective antagonists, such as montelukast, zafirlukast, and pranlukast, are currently used in the treatment of asthma. Recently, two types of CysLT receptors, CysLT₁ and CysLT₂, have been cloned, and identified to be G protein-coupled receptors and to mediate CysLT effects^[2-7]. CysLT₁ receptor mRNA presents in human lung smooth muscle cells, lung macrophages, most peripheral blood eosinophils and pregranulocytic CD34+ cells, and in subsets of monocytes and B lymphocytes^[8]. In contrast to the CysLT₁ receptor, the strongest expression of the CysLT₂ receptor in the lung has been detected in interstitial macro-phages, but distinctly weaker expression in smooth muscle cells. CysLT₂ receptor expresses abundantly in peripheral blood cell, and especially strong in human eosinophils^[9].

The contribution of the CysLT receptors to bronchial asthma has been established by the therapeutic efficacy of CysLT biosynthetic inhibitors^[10] and selective CysLT₁ receptor antagonists^[11]. Ovalbumin sensitization and aerosol challenge in mice elicits LTB₄ and LTC₄ release into bronchoalveolar lavage (BAL) fluid, eosinophilia in the mucosa and the BAL fluid, and the increased airways reactivity to methacholine^[12,13]. Although the involvement of CysLTs in bronchocons-triction is not established in mice^[14,15], a CysLT₁ receptor selective antagonist, MK-571, recently has been shown to inhibit eosinophilia, bronchial hyperreactivity, and microvascular leakage in a mouse model^[16]. Furthermore, in LTA₄ hydrolase gene-disrupted mice subjected to zymosan A-induced peritonitis, neutrophil recruitment was decreased, and protein extravasation because of increased vascular permeability in the peritoneal cavity was substantial^[17]. These findings are consistent with the absence of LTB₄ and the increased CysLT generation that attribute to shunting of LTA₄ to LTC₄ synthase. In addition, CysLTs directly increase venular permeability and edema formation at the administration site in mice^[18,19].

The roles of CysLTs in asthma have been well investigated. However, no direct evidence elucidates the expressions of CysLT₁ and CysLT₂ receptors in airway inflammation of asthma. To clarify the implications of CysLT receptors in airway eosinophilic inflam-mation, we detected the expressions of CysLT₁ and CysLT₂ receptor mRNAs by RT-PCR and the effect of montelukast, a CysLT₁ receptor antagonist, in the lungs of asthmatic mice that were chronically induced by ovalbumin sensitization and aerosol challenge in this study.

MATERIALS AND METHODS

Drugs and reagents Montelukast was a gift from MERCK Research Laboratories (USA); chicken ovalbumin (OVA, grade V) was from Sigma Chemicals, USA; inject alum was from PIERCE Co, USA; recombination mouse IL-5 standard, purified anti-mouse IL-5 antibody, and biotinilated anti-mouse secondary antibody were from Rockland Chemical Co; Trizol for extracting RNA was from Bio Basic Inc, Canada; and chemicals for RT-PCR were from Takara Co, Japan.

Ovalbumin sensitization and challenge^[20] Male C57BL/6 mice, weighing 18-22 g, were purchased from Shanghai Experimental Animal Center of Chinese Academy of Sciences. Mice were sensitized by intraperitoneal injections (100 µL) of 20 µg OVA emulsified in 2 mg of Inject Alum [Al (OH)₃/Mg(OH) ₂] on d 0 and d 14. Mice were subsequently challenged with 2 % OVA aerosol in saline or saline alone for 45 min by ultrasonic nebulization from d 24 to d 41. Montelukast (6 mg/kg) was orally given once daily for 20 d from d 23 to d 42.

Bronchoalveolar lavage fluid (BAL) eosinophil count On d 43, mice were sacrificed and their lungs were lavaged three times with 0.5 mL of PBS containing 2 % FCS. The recovered BAL fluids were pooled and centrifuged, generating a BAL cell pellet and a cell-free supernatant. Total cell counts were determined with a hemacytometer, and eosinophils were counted on Wright stained cytospin slides (Cytospin 3, Shandon Scientific, Pittsburgh, PA) by counting ³300 cells. Cell-free lavage fluid was frozen on dry ice and stored at -70 ºC until use.

Lung histology The left lobes of lungs were fixed in 10 % buffered formalin. After embedding in paraffin, the tissues were cut into 5-µm thick sections. Eosinophils were stained with Discombe's solution (0.05 % aqueous eosin and 5 % acetone in distilled water, v/v) for 5 min, rinsed with distilled water, and counterstained with 0.07 % methylene blue.

Interleukin-5 (IL-5) assay IL-5 levels in BAL fluids were measured by ELISA method according to the manufacturer's guideline for users. The limit of this assay was 5 ng/L.

Semi-quantitative RT-PCR Total RNA was prepared from 0.1 mg of the lung tissues with Trizol reagents according to the manufacturer's guidelines. For cDNA synthesis, 20 µL reverse transcription mixture containing total RNA 1 µg, dNTP 1 mmol/L, random primer 0.2 µg, RNasin 20 U, M-MuLV reverse transcriptase 200 U were mixed and incubated at 42 ºC for 60 min, and then the reverse transcriptase was inactivated by heating the reaction mixture at 70 ºC for 10 min.

Oligonucleotide primers specific for mouse CysLT₁, CysLT₂, and G3PDH (an internal standard) were synthesized according to published sequences^[8]: CysLT₁: (+) CAACGAACTATCCACCTTCACC, (-) AGCCTTCTCCTAAAGTTTCCAC; CysLT₂: (+) GTCCACGTGCTGCTCATAGG, (-) ATTGGCTGCA-GCCATGGTC; G3PDH: (+) AGGTTGTCTCCTGCGA-CTTC, (-) CTTGCTCAGTGTCCTTGCTG; with the product sizes 162 bp, 180 bp, and 210 bp respectively. PCR reactions were performed on Eppendorf Master Cycler. The reaction conditions were as follows: 2 µL of cDNA mixture was subjected to amplification in 50 µL of final volume with MgCl₂ 1.5 mmol/L, dNTPs 0.2 mmol/L, 20 pmol of each primer, and 2 U of Taq DNA polymerase in the reaction buffer. PCR reactions were as follows: 94 ºC, 5 min; then 94 ºC, 1 min, 65 ºC for CysLT₁, 67 ºC for G3PDH and 68 ºC for CysLT₂, 1 min; 72 ºC, 45 s, for 30 cycles; and 72 ºC 10 min to end the reaction. PCR products of 10 µL were separated by 1.8 % agarose gel electrophoresis and visualized using ethidium bromide staining. The density of each band was measured by UVP gel analysis system. This semi-quantitative measure was expressed as ratios compared with G3PDH.

Statistical analysis All values were presented as mean±SD. One-way ANOVA was used for statistical analysis of the differences between groups. P<0.05 was considered statistically significant.

RESULTS

Airway eosinophilic inflammation in OVA-sensitized mice After chronically repeated OVA sensitization and challenge, severe airway eosinophilic inflammation appeared in the pulmonary interstitium with numerous eosinophils around the bronchioles and blood vessels as compared to control (Fig 1A-B). Montelukast treatment attenuated eosinophil infiltration (Fig 1C). Eosinophils in both BAL fluid and lung parenchyma significantly increased in chronically OVA-challenged mice, and eosinophils were the predominant inflammatory cells. Montelukast treatment significantly reduced the numbers of total cells and eosinophils in both BAL fluid, and eosinophils in lung parenchyma by 55.9 %, 95.5 %, and 88.5 %, respectively (Tab 1).

Fig 1. Effect of montelukast on eosinophil infiltration in the pulmonary interstitium. A: control; B: OVA-challenged, there were numerous eosinophils around the bronchioles; C: montelukast- and OVA-treated, there were fewer eosinophils in the peribronchioles tissues.

Tab 1. Inhibitory effect of montelukast (MK) on eosinophils in BAL fluid and around bronchioles and blood vessels in chronically OVA-challenged mice. n=8. Mean±SD. ^cP<0.01 vs saline control. ^fP<0.01 vs OVA challenge alone; one-way ANOVA.

	10-7×BALF cells·L-1		10-3×Eosinophils
Treatment	Total	Eosinophils	around bronchioles
		(%)	and blood
			vessels/mm-2
Saline	22±7	0.02±0.01 (0.09)	0.006±0.003
OVA	152±57c	51±5 (33.7)c	1.03±0.07c
OVA+MK	67±20cf	2.3±0.4 (3.43)cf	0.16±0.02cf

IL-5 level in BAL fluid IL-5 level in BAL fluid of OVA-challenged mice was 2.15-fold higher than control mice, and montelukast treatment decreased IL-5 level by 51.0 % (P<0.01, Fig 2).

Fig 2. Effect of montelukast on the level of IL-5 in BAL fluid. n=5. Mean±SD. ^cP<0.01 vs control. ^fP<0.01 vs OVA-challenged mice.

CysLT₁ and CysLT₂ mRNA expressions in the lungs of mice CysLT₁ and CysLT₂ expressions in the lungs of mice were examined by RT-PCR, and only one band of each predicted size for CysLT₁ (162 bp) and CysLT₂ (180 bp) was found (Fig 3). The expression of CysLT₁ mRNA increased 1.3-fold in OVA-challenged mice (P<0.05 vs control), and montelukast treatment decreased the enhanced expression of CysLT₁ mRNA by 3.4-fold (P<0.01, Fig 4). However, the expression of CysLT₂ mRNA decreased 1.7-fold in OVA-challenged mice (P<0.05), but montelukast treatment had no effect on the decreased expression of CysLT₂ mRNA (Fig 4).

Fig 3. Agarose gel electrophoresis of PCR products. C2 and C1: CysLT₂ and CysLT₁ of control group; O2 and O1: CysLT₂ and CysLT₁ of OVA challenged group; M2 and M1: CysLT₂ and CysLT₁ of montelukast-treated group; G: G3PDH (an internal standard).

Fig 4. Effect of montelukast on CysLT₁ and CysLT₂ receptor mRNA expressions in the lungs of mice. n=5. Mean±SD. ^bP<0.05 vs control. ^eP<0.05 vs OVA.

DISCUSSION

In this study, a severe airway eosinophilic inflammation and higher level of IL-5 in BAL fluid have been found in a mouse model of asthma, and these alterations can be inhibited effectively by montelukast, a CysLT₁ receptor antagonist. Also, up-regulation of CysLT₁ and down-regulation of CysLT₂ receptor mRNA expression were found in the lungs of asthmatic mice, and montelukast inhibited the enhanced CysLT₁ receptor expression, but not CysLT₂ receptor. These findings clearly indicate that CysLTs plays an important role in airway eosinophilic inflammation induced by repeated exposure to antigen, and that CsyLT receptors in the lung can be modulated both immunologically and pharmacologically. Evidence for the role of CysLTs in airway eosinophilic inflammation in our study is the results that montelukast greatly suppresses eosinophil infiltration in both pulmonary interstitium and BAL fluid of asthmatic mice. Same effect of montelukast is also reported in acute asthma model of BALB/c mice^[21], and another CysLT₁ receptor antagonist pranlukast can inhibit human eosinophil activation^[22]. These results support the hypothesis that CysLTs induce migration and enhance degranulation of eosinophils via CysLT₁ receptor^[23]. Furthermore, eosinophils are regulated by a network of cytokines and IL-5 plays a critical role^[24], and these are confirmed by the elevation of IL-5 level in BAL fluid in our study.

Interestingly, we found that CysLT receptor expressions in the lungs of asthmatic mice were modulated by both chronic antigen exposure and CysLT₁ receptor antagonist. CysLT₁ receptor is up-regulated and CysLT₂ receptor is down-regulated immunologically. We can not explain the reasons for these changes. But one of the possible reasons for up-regulation of CysLT₁ may be related to the elevation of IL-5 level in BAL fluid as we found. IL-5 has been reported to up-regulate CysLT₁ receptor expression in HL-60 cells differentiated toward the eosinophils^[25]. Also, other cytokines like IL-13, IL-4, IFN-g and TGF-b increase CysLT₁ receptor expression^[26-28]. The increased CysLT₁ receptors may potentiate the CysLT-mediated actions of eosinophils and pulmonary cells on airway eosinophilic inflammation and airway hyperresponsiveness as mentioned above. How-ever, the reason why the expression of CysLT₂ mRNA decreased in OVA-challenged mice is unclear.

More important finding in this study is that montelukast inhibits the enhanced CysLT₁ receptor expression in the lungs of asthmatic mice that related to suppression of eosinophilic inflammation functionally. Since eosinophils, macrophages, and other cells in the lung express CysLT₁ receptor, reduced inflammatory cells by montelukast in the lung may result in a lower expression of CysLT₁ receptor. Another possible reason is inhibition of IL-5 level in BAL fluid by montelukast that may attenuate one modulator for the up-regulation of CysLT₁ receptor expression, but the causal relation is unknown. The mechanism(s) should be further investigated on the basis such as cytokine network, intracellular signal transduction pathways, and receptor-antagonist interactions. But we can not explain why montelukast reduced the expression of CysLT₁ receptor even in the lungs of control mice. In contrast, montelukast did not reverse the reduced expression of CysLT₂ receptor.

In summary, we found the effect of montelukast on airway eosinophilic inflammation and up-regulation of CysLT₁ receptor expression in the lungs of asthmatic mice. Our results provide the evidence of the immunological and pharmacological modulation of CysLT receptor expressions in the lung, and further studies are needed to clarify characteristics and mechanisms like the involved cell types, up- and down-stream events, and time- and dose-dependence.

ACKNOWLEDGMENT We thank Dr John Obenchain, MERCK Research Laboratories, USA, for the supply of montelukast.

REFERENCES

1 Shimizu T, Wolfe LS. Arachidonic acid cascade and signal transduction. J Neurochem 1990; 55: 1-15.

2 Metters KM. Leukotriene receptors. J Lipid Mediat Cell Signal 1995; 12: 413-27.

3 Piper PJ. Formation and actions of leukotrienes. Physiol Rev 1984; 64: 744-61.

4 Heise CE, O'Dowd BF, Figueroa DJ, Sawyer N, Nguyen T, Im DS, et al. Characterization of the human cysteinyl leukotriene 2 receptor. J Biol Chem 2000; 275: 30531-6.

5 Takasaki J, Kamohara M, Matsumoto M, Saito T, Sugimoto T, Ohishi T, et al. The molecular characterization and tissue distribution of the human cysteinyl leukotriene CysLT₂ receptor. Biochem Biophys Res Commun 2000; 274: 316-22.

6 Nothacker HP, Wang Z, Zhu Y, Reinscheid RK, Lin SH, Civelli O. Molecular cloning and characterization of a second human cysteinyl leukotriene receptor: discovery of a subtype selective agonist. Mol Pharmacol 2000; 58: 1601-8.

7 Ogasawara H, Ishii S, Yokomizo T, Kakinuma T, Komine M, Tamaki K, et al. Characterization of mouse cysteinyl leukotriene receptors mCysLT₁ and mCysLT₂: differential pharmacological properties and tissue distribution. J Biol Chem 2002; 277: 18763-8.

8 Figueroa DJ, Breyer RM, Defoe SK, Kargman S, Daugherty BL, Waldburger K, et al. Expression of the cysteinyl leukotriene 1 receptor in normal human lung and peripheral blood leukocytes. Am J Respir Crit Care Med 2001; 163: 226-33.

9 Heise CE, O'Dowd BF, Figueroa DJ, Sawyer N, Nguyen T, Im DS, et al. Characterization of the human cysteinyl leukotriene 2 receptor. J Biol Chem 2000; 275: 30531-6.

10 Israel E, Dermarkarian R, Rosenberg M, Sperling R, Taylor G, Rubin P, et al. The effects of a 5-lipoxygenase inhibitor on asthma induced by cold, dry air. N Engl J Med 1990; 323:1740-4.

11 Manning PJ, Watson RM, Margolskee DJ, Williams VC, Schwartz JI, O'Byrne PM. Inhibition of exercise-induced bronchoconstriction by MK-571, a potent leukotriene D₄-receptor antagonist. N Engl J Med 1990; 323: 1736-9.

12 Henderson WR Jr, Lewis DB, Albert RK, Zhang Y, Lamm WJE, Chiang GKS, et al. The importance of leukotrienes in airway inflammation in a mouse model of asthma. J Exp Med 1996; 184: 1483-94.

13 Irvin CG, Tu YP, Sheller JR, Funk CD. 5-Lipoxygenase products are necessary for ovalbumin-induced airway responsiveness in mice. Am J Physiol 1997; 72: L1053-8.

14 Martin TR, Gerard NP, Galli SJ, Drazen JM. Pulmonary responses to bronchoconstrictor agonists in the mouse. J Appl Physiol 1988; 64: 2318-23.

15 Richter M, Sirois P. Effects of eicosanoids, neuromediators and bioactive peptides on murine airways. Eur J Pharmacol 2000; 389: 225-34.

16 Blain JF, Sirois P. Involvement of LTD₄ in allergic pulmonary inflammation in mice: modulation by cysLT₁ antagonist MK-571. Prostaglandins Leukotrienes Essent Fatty Acids 2000; 62: 361-8.

17 Byrum RS, Goulet JL , Snouwaert JN , Griffith RJ, Koller BH. Determination of the contribution of cysteinyl leukotrienes and leukotriene B₄ in acute inflammatory responses using 5-lipoxygenase- and leukotriene A₄ hydrolase-deficient mice. J Immunol 1999; 163: 6810-9.

18 Griswold DE, Webb EF, Clark MA, Mong S. Phlogistic activity of leukotriene D₄ in the mouse. Inflammation 1986; 10: 1-7.

19 Griswold DE, Webb EF, Hillegass LM. Induction of plasma exudation and inflammatory cell infiltration by leukotriene C₄ and leukotriene B₄ in mouse peritonitis. Inflammation 1991; 15: 251-8.

20 Shen HH, Ochkur SI, McGarry MP, Crosby JR, Hines EM, Brochers MT, et al. A causative relationship exists between eosinophils and the development of allergic pulmonary pathologies in the mouse. J Immunol 2003; 170: 3296-305.

21 Wu AY, Chik SC, Chan AW, Li Z, Tsang KW, Li W. Anti-inflammatory effects of high-dose montelukast in an animal model of acute asthma. Clin Exp Allergy 2003; 33: 359-66.

22 Suzuki M, Kato M, Kimura H, Fujiu T, Morikawa A. Inhibition of human eosinophil activation by a cysteinyl leukotriene receptor antagonist (pranlukast; ONO-1078). J Asthma 2003; 40: 395-404.

23 Ohshima N, Nagase H, Koshino T, Miyamasu M, Yamaguchi M, Hirai K, et al. A functional study on CysLT₁ receptors in human eosinophils. Int Arch Allergy Immunol 2002; 129: 67-75.

24 Matsumoto N, Katoh S, Mukae H, Matsuo T, Takatsu K, Matsukura S. Critical role of IL-5 in antigen-induced pulmonary eosinophilia, but not in lymphocyte activation. Int Arch Allergy Immunol 2003; 130:209-15.

25 Thivierge M, Doty M, Johnson J, Stankova J, Rola-Pleszczynski M. IL-5 up-regulates cysteinyl leukotriene 1 receptor expression in HL-60 cells differentiated into eosino-phils. J Immunol 2000; 165: 5221-6.

26 Thivierge M, Stankova J, Rola-Pleszczynski M. IL-13 and IL-4 up-regulate cysteinyl leukotriene 1 receptor expression in human monocytes and macrophages. J Immunol 2001; 167: 2855-60.

27 Amrani Y, Moore PE, Hoffman R, Shore SA, Panettieri RA. Interferon-g modulates cysteinyl leukotriene receptor-1 expression and function in human airway myocytes. Am J Respir Crit Med 2001; 164: 2098-101.

28 Espinosa K, Bosse Y, Stankova J, Rola-Pleszczynski M. CysLT₁ receptor upregulation by TGF-b and IL-13 is associated with bronchial smooth muscle cell proliferation in response to LTD₄. J Allergy Clin Immunol 2003; 111: 1032-40.