Zhang CS et al / Acta Pharmacol Sin 2004 Aug; 25 (8): 1022-1026

Polymorphism of Prodynorphin promoter is associated with schizophrenia in Chinese population1

Chang-shun ZHANG2,3, Zheng TAN2,3, Lan YU2,3, Sheng-nan WU2,3, Ying HE2,3, Niu-fan GU4, Guo-yin FENG4, Lin HE 3,2,5

2Bio-X Life Science Research Center, Shanghai Jiao Tong University, Shanghai 200030; 3Institute of Nutrition Science, Chinese Academy of Sciences, Shanghai 200031; 4Shanghai Institute of Mental Health, Shanghai 200030, China

Note: Chang-shun ZHANG and Zheng TAN have contributed equally to this work.

1 Project supported by the State Key Basic Research and Development Program of China, "973 Project", No 20001-CB5103; National High Technology Program of China, "863 Projects", No 2002BA711A07; the Royal Society of the UK; Shanghai Municipal Commission for Science and Technology and the NARSAD award.

5 Correspondence to Prof Lin HE. Phn/Fax 86-21-6282-2491. E-mail helin@sjtu.edu.cn

Received 2003-06-17 Accepted 2004-02-18

KEY WORDS neuropeptides; prodynorphin; single nucleotide polymorphism; schizophrenia

ABSTRACT

AIM: To investigate the correlation between single nucleotide polymorphisms (SNPs) of functional candidate gene Prodynorphin (PDYN) and schizophrenia. METHODS: SNPs in the promoter and exon regions of PDYN were screened and genotyped for association study in a cohort of Chinese Han schizophrenia cases and controls. RESULTS: Two SNPs PDYN-1576C>T and PDYN-946C>G were identified in the promoter region but PDYN-946C>G showed significant differences of allele distribution (c2=6.15, P=0.013) and genotype distribution (c2=6.87, P=0.032) between schizophrenic and control subjects. CONCLUSION: PDYN-946C>G polymorphism demonstrated an association with population susceptibility to schizophrenia (P<0.05).

INTRODUCTION

Schizophrenia is one of the most common mental illnesses, with a lifetime prevalence of 1 %. This disease should be caused by a combination of multiple genes and nongenetic components, or by the epistasis model in which a few genes acting jointly cause the illness. Thus, candidate genes identified on the basis of biochemical and pharmacological evidence are being tested for linkage and association studies.

Previously, most association studies of schizophrenia have focused on neurotransmitters such as serotonin and dopamine pathways but the role of neuropeptides has seldom been explored. Experimental and clinical studies suggest an involvement of the opioid neuropeptide system in schizophrenia. Opioid peptides are a family of neuropeptides which derive from three precursor gene products: proenkephalin A, proopiomelano-cortin and proenkephalin B (prodynorphin, PDYN)[1]. In particular, prodynorphin, the precursor of the dynorphin opioid peptides, has been shown to play an important role in several aspects of human diseases and complex traits, eg, drug abuse, epilepsy, and mood disorders[2]. In human brain, PDYN is highly expressed in limbic-related areas such as the amygdala, hippocampus, ventral striatum, patch compartment of the dorsal striatum, entorhinal cortex, and hypothalamus[3], while nerve terminals and fibers containing these peptides are found in SN, globus pallidus, and raphe nuclei, etc. Peptides derived from prodynorphin, such as a-opioid receptors[4]. Studies indicate that PDYN changes its expression level under several pathophysiologically important conditions. The prodynorphin mRNA expression was increased in the patch vs matrix compartment of the caudate nucleus in suicide subjects and reduced in discrete nuclei of the amygdaloid complex in subjects with major depression or bipolar disorder[1,5]. Also the dysphoric effects of marijuana was found to be mediated by endogenous opioid peptide[6].

In this work, we investigated the correlation between PDYN and schizophrenia.

MATERIALS AND METHODS

Subjects A total of 250 unrelated schizophrenics (mean age of onset=28.2±8.0) were recruited from Shanghai Mental Health Center. All the patients had two or more of the following characteristic symptoms and each lasted a significant portion of a month (or less if successfully treated): delusions; hallucinations; disorganized speech; grossly disorganized or catatonic behaviour and negative symptoms, ie, affective flat-tening, alogia, or avolition. Consensus diagnosis of each patient was made by two independent psychiatrists based on DSM-IV (Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition) criteria for schizophrenia (American Psychiatric Association, 1994). Two hundred unrelated healthy subjects (mean age=31.2±8.0) from Shanghai were used as controls. These samples were recruited in medical examinations of faculty or general staff of Shanghai Mental Health Center and Shanghai Jiao Tong University. All of them were interviewed to exclude any history of psychiatric disorders. Informed consents were obtained for all the individuals tested. Thirty-two samples comprised of 16 cases and 16 controls were used for SNP screening.

Gene screen The genomic DNA sequence of PDYN was downloaded from Golden Path (http://genome.ucsc.edu/goldenPath/hgTracks.html) for primer design using Vecotr NTI suite6 (InforMax, Inc) and primer3 (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3.cgi/; Tab 1). All the promoter and exon regions of the gene were screened with the primers.

PCR amplification PCR was performed in a total volume of 25 µL containing 10 ng genomic DNA, 1×buffer, MgCl2 1.5mmol/L, dNTPs 0.2 mmol/L, 8 pmol of each primer, 1 unit Hotstar polymerase, in a thermal cycler (GeneAmp 9700, Appllied Biosystem). Conditions for PCR were as follows: 95 ºC for 12 min, followed by 35 cycles of 94 ºC for 30 s, 58 ºC for 30 s, 72 ºC for 30 s, and finally 72 ºC for 5 min. The PCR product was visualized on a 1.5 % agarose gel stained with ethidium bromide.

Sequencing of amplicon PCR products were purified with 96 multiscreen filter plates (Millipore Inc). Amplicon was sequenced on sequencer ABI 3100 using individual PCR primer with Big Dye version 3 (Applied Biosystems).

Sequence data processing and SNP identification The Phred and Phrap software programs were used for base calling and assembly of the chromato-grams. Assemblies were edited and reviewed in Consed. Edited and complete assemblies were processed using PolyPhred software with a quality threshold of 20 to identify putative SNPs. Chromatograms were visually inspected to cull false-positive SNPs. The genotype of each SNP was visually confirmed by inspection of the chromatograms.

Statistical analysis c2 value, P value and odds ratio were calculated by SPSS 10.0 and InStat 3.05. Hardy-Weinberg equilibrium analysis was conducted using Arlequin.

RESULTS AND DISCUSSION

We identified 2 SNPs in the promoter region of PDYN (Tab 1) for association study in a cohort of Chinese Han schizophrenia cases and controls. Due to the positive result with PDYN -946C>G, we studied it in detail. Tab 2 and 3 revealed its allelic frequencies and genotypic distributions between cases and controls. The distribution of genotypes showed no deviation from Hardy-Weinberg equilibrium. In this work, we found significant differences of allele distribution (c2 =6.15, P=0.013) and genotype distribution (c2 =6.87, P=0.032) between schizophrenic and normal subjects.

Tab 1. PCR primers for SNP screening of the PDYN gene and SNPs1) identified.

Region

Primers

PCR product size

Polymorphisms

Flanking sequences

Promoter

5'- tggagtgatttgaggactgg

489

-1576C>T

tggccttctaT/Cgtgtgtgtgt

 

5'- ctgcatttgcctttcctctc

 

 

 

 

5'-ccagggtggcaatgaataga

442

-946C>G

agacagggagG/Cagaaggaaag

 

5'-gtagaaggggctgtttgctg

 

 

 

 

5'-ctgctcctggccttctatgt

518

 

 

 

5'-cacatctcaggctggcttct

 

 

 

 

5'-ccagggtggcaatgaataga

442

 

 

 

5'-gtagaaggggctgtttgctg

 

 

 

 

5'-ggatgtgatggaatgtggaa

451

 

 

 

5'-cttgaatctgcccacactga

 

 

 

 

5'-gagaggctgagtcccagaga

371

 

 

 

5'-tcctcatgacctagccagttg

 

 

 

Exon 1

5'-ttggaggatagatggacctga

452

 

 

 

5'-tagcaggaaaaacccctcaa

 

 

 

 

5'-tccaggccaagggtatattg

474

 

 

 

5'-caaggagagagggacagagc

 

 

 

 

5'-cgtctgtctgtctgtggatca

424

 

 

 

5'-ggcctgacacaataggcttc

 

 

 

 

5'-caaacagcactacacccagaa

475

 

 

 

5'-tcccaccatctctaggtcca

 

 

 

Exon 2

5'-tcaagaatccctccaagctc

578

 

 

 

5'-gcctgctcccttaaaatgtg

 

 

 

Exon 3

5'-attcccttccttgacccttg

492

 

 

 

5'-gccatctatagggcaggaca

 

 

 

Exon 4

5'-tagcagtggcgttcattttg

506

 

 

 

5'-tagcgtttgacctgctcctt

 

 

 

 

5'-ccatggagactggcacact

439

 

 

 

5'-aggctgggcttggatatttt

 

 

 

1) SNPs are named according to the nomenclature recommended by Antonarakis. For promoter SNPs, the A of the the ATG of the initiator Met codon is denoted nucleotide +1. The nucleotide 51 to +1 is numbered -1.

Tab 2. Distribution of alleles.

SNP

Group2)

1

2

c2

P

Odds ratio

95 % ondidence
intervasls (CI)

PDYN-946C>G

Case (n=223)

48 (0.11)

398 (0.89)

6.15

0.013

1.7

1.13-2.56

 

Control (n=179)

61 (0.17)

297 (0.83)

 

 

 

 

2) Due to the failure of PCR amplification, the number of samples used for statistical analysis is less than that collected.

Tab 3. Distribution of genotypes.

SNP

Group

113)

223)

123)

c2

P

Hardy-weinberg
equilibrium
c2 (P)

PDYN-946C>G

Case (n=223)

2

177

44

6.87

0.032

 

 

Control (n=179)

6

124

49

 

 

0.18 (0.67)

3) Alleles 1 and 2 represent the first and second nucleotides given in the name of the SNP, respectively.

Altered expression of PDYN has been observed in several experimental models of psychiatric and neurological diseases. An increase of dynorphin A peptides was detected in the cerebrospinal fluid (CSF) of drug-free schizophrenics[7], and reduced CSF levels of dynorphin (1-8) immunoreactivity was reported in patients diagnosed with schizophrenia[8]. Zimprich et al described a polymorphism of PDYN promoter: 1 to 4 repeats of a 68-bp element containing 1 binding site per repeat for the transcription factor AP1. Upon activation of the AP1 complex, H alleles (3 or 4 repeats) were associated with a significant increase in gene expression in a CAT reporter gene assay, whereas L alleles could not be stimulated over basal conditions[2]. Ventriglia M et al revealed that the functional polymorphism in the promoter of PDYN by an epistatic interaction with the Gly allele of DRD3 gene might contribute to susceptibility to schizophrenia[9].

The opioid system has important functions in controlling pain, reward and addiction. It is also implicated in numerous other processes within and outside the nervous system. Prodynorphin transcription has been postulated as an important molecular mechanism involved in adaptation/repair processes. Expression of prody-norphin is modulated by the levels of the second messengers cAMP and Ca2+: an elevation of intracellular cAMP levels causes the increase of prodynorphin mRNA levels; Ca2+ release from internal stores has been found to promote an increase of prodynorphin mRNA levels. Further study demonstrated Ca2+-dependent prody-norphin gene transcription was insensitive to the broad-spectrum kinase inhibitors but sensitive to agents that alter internal Ca2+ accumulation[10]. Traumatic brain injury (TBI), which can increase intracellular calcium levels, can transiently increase prody-norphin mRNA in the hippocampus. Moreover, dynor-phin peptide immunoreactivity is enhanced for up to 24 h after TBI, which may serve a beneficial role for memory formation and storage after TBI[11]. With regard to addiction, significant increase in prodynorphin mRNA level was observed in the hippocampal dentate gyrus after acute (cocaine) and chronic (cocaine, amphe- tamine) administration of the psychostimulants[12]. Furthermore, Dynorphin A has cytotoxic effects. It may be relevant for a pathophysiological role of dynor-phins in the brain and spinal cord and for control of death of tumor cells, which express prodynorphin at high levels[13]. Endogenous dynorphins may induce hyperacusis and can contribute to the induction, main-tenance, or exacerbation of tinnitus (the perceptual correlate of altered spontaneous neural activity occurring without an external auditory stimulusin the auditory periphery)[14].

Our finding suggests that the presence of the specific promoter polymorphism increase the susceptibility to schizophrenia in Chinese population, which supports the previous study. However, it seems that only the stimulus (phorbol ester) induces gene expression but the basal transcription rate is influenced by the number of repeat elements. Additional investigation with more advanced study should be conducted to confirm the relationship between this polymorphism and mRNA expression in order to better understand the etiology of schizophrenia.

REFERENCES