Lei ZB et al / Acta Pharmacol Sin 2003 Jul; 24 (7): 670-674
LEI Zhu-Bin, FU Xu-Jie, LU Zhao-Tong, WANG Bao-Cheng, LIU Xian-Liang, YOU Nai-Zhen
Department of Cardiology, General Hospital of Ji'nan Military Area, Ji'nan 250031, China
1 Project supported by the Medicinal Foundation of the Chinese People's Liberation Army (01Q015).
2 Correspondence to Prof LEI Zhu-Bin. Phn 86-531-216-6798; 86-531-216-6206. E-mail leizhubin88@email.com.cn or leizhubin@hotmail.com
Received 2002-04-03 Accepted 2003-03-01
KEY WORDS 17
-estradiol;
chemokine receptors; monocytes; flow cytometry; reverse transcriptase
polymerase chain reaction
ABSTRACT
AIM: To study the effect of 17
-estradiol
on expression of chemokine receptor CXCR2 in monocytes in vivo. METHODS:
Expressions of chemokine receptor CXCR2 mRNA and protein were measured by
RT-PCR and flow cytometry, respectively. RESULTS: In both ovary-intact
and ovariectomized (OVX) rats, CXCR2 protein and mRNA expression
were significantly increased in rats fed with a high-cholesterol
diet for 6 weeks. The cholesterol-induced increases in CXCR2 protein and mRNA
expression were significantly attenuated in OVX rats injected with
estradiol-17
(17
-E2)
(5 and 20 µg·kg-1·d-1). In normal diet
rats, CXCR2 protein and mRNA expression were increased in OVX rats
compared with ovary-intact rats, and this increase was prevented by 17
-E2.
CONCLUSION: Both basal and hypercholesterolemia-induced increases in
chemokine receptor CXCR2 are modulated by physiological concentrations of estradiol.
INTRODUCTION
Women are protected by coronary artery disease until their sixth decade and
beyond. Ovarian hormones are vasoactive substances that inhibit atheroma formation.
The adhesion of monocytes to endothelial cells[1,2] is
essential elements of an inflammatory response and occurs continuously
throughout the entire atherogenic process. It has been presented
that estradiol supplementation to ovariectomized (OVX) rats fed a
cholesterol-enriched (0.5 %) diet inhibits the adhesion of monocytes
to endothelial cells in vivo when compared with
OVX rats not receiving estrogen supplementation[3]. It is therefore
possible that estradiol inhibits the development of atherosclerotic
lesions by regulating the inflammatory component of the atherogenic
process. Recent studies suggest that CXC chemokines may be involved in the pathogenesis
of atherogenesis. A potential role in atherogenesis of growth-regulated oncogene
(GRO), IL-8, and their shared receptor, CXCR2, which is normally expressed in
circulating monocytes[4,5], is receiving increasing attention[6].
We have found that estrogen acts to inhibit GRO
expression in human endothelial cells and the
inhibition may be mediated through estradiol receptor
[7].
The inhibition of GRO
may be functionally
associated with a lessened adhesion of monocytes to human endothelial cells.
IL-8 is a powerful trigger for firm adhesion of monocytes to vascular endothelium[8].
Furthermore, mice lacking CXCR2 are less susceptible to atherosclerosis and
have fewer monocytes in vascular lesions[9].
Based on these data, we therefore assessed whether feeding a cholesterol-enriched diet to rats may increase the production of CXCR2 in the fresh peripheral blood monocytes and whether supplementation with estradiol could inhibit its production.
MATERIALS AND METHODS
Chemicals and reagents FCS and RPMI-1640 were purchased from Gibco-BRL. Phycoerythrin-conjugated mouse antibody IgG1 (AbIgG1), and phycoerythrin-conjugated mouse anti-rat CXCR2 monoclonal antibody (AbCXCR2) were generous gifts from Dr ZHAO Z (Beijing, China). All other reagents, unless indicated, were from Sigma Chemical Co.
Animal procedures All animal procedures were
approved by the local government authorities.
Twelve-week-old (average weight, 222 g; range, 214-233 g)
female Sprague-Dawley rats were used in all experiments. The animals were
housed at 21 ºC with a 12-h light and 12-h dark cycle and were fed
rat laboratory diet (Lillico, Betchworth, Surrey, UK). The
animals were pair-fed. Water was available
ad libitum. The rats were either OVX or sham-operated.
Physiological plasma levels of estrogen in the ovariectomized
rats were maintained as previous
study[10]. After surgery, rats received vehicle (Veh), or
17
-estradiol 5
µg·kg-1·d-1, or
17
-estradiol 20
µg·kg-1·d-1 as a daily sc injection
(17
-estradiol was dissolved in 95
% corn oil/5 % benzyl alcohol). Blood was
taken at 6th week postsurgery, and was used for
subsequent FACS or RT-PCR analysis.
Experimental protocols Rats were divided into 8 groups (n=8,
each group): (1) ovary-intact animals fed with normal diet; (2) ovary-intact
animals with sham operation fed with a 0.5 % cholesterol diet for 6
weeks;(3) OVX animals with Veh and fed with a 0.5 % cholesterol
diet for 6 weeks; (4) OVX animals with Veh and fed with a normal
diet for 6 weeks; (5) OVX animals received 17
-estradiol
5 µg·kg-1·d-1 and fed with normal diet
for 6 weeks; (6) OVX animals received 17
-estradiol
5 µg·kg-1·d-1 and fed with a 0.5 % cholesterol
diet for 6 weeks; (7) OVX animals received 17
-estradiol
20 µg·kg-1·d-1 and fed with
normal diet for 6 weeks; and (8) OVX animals received 17
-estradiol
20 µg· kg-1·d-1 and fed with a 0.5 % cholesterol
diet for 6 weeks.
Cell separation At the end of the feeding period the animals were euthanized, and blood samples were collected by cardiac puncture into vacuum tubes containing edetic acid to prevent coagulation. Mononuclear cells were isolated by Ficoll-Hypague method[11]. After adherence to plastic, cells were cultured at 37 ºC in a 5 % CO2 incubator for 2 h and the non-adherent cells were removed. The adhered cells were harvested (monocytes>90 %).
Reverse transcription-PCR (rt-PCR) analysis Total mRNA from 1×106 monocytes was isolated with TRIzol (Gibco). First strand cDNA was then synthesized from 2 µg total RNA using reverse transcriptase (Gibco). A parallel control for DNA contamination was carried out without adding reverse transcriptase in the first strand synthesis. Primers were synthesized according to motif: CGGAATTCAAATGGAAGATTTTA-ACATGGAG (CXCR2, sense), CCGCTCGAGTTAGA-GAGTAGTGGAAGTGTG (CXCR2, antisense), TCCATGACAACTTTGGCATCGTGG (GAPDH, sense), and GTTGCTGTTGAAGTCACAGGAGAC (GAPDH, antisense). PCR amplification of CXCR2 cDNA for 40 cycles was 94 ºC denaturation (60 s), 58 ºC annealing (60 s), and 72 ºC extension (60 s). A 500-ng aliquot of total RNA was reverse-transcribed under similar conditions followed by PCR amplification of GAPDH cDNA for 30 cycles. PCR products were analyzed by 2 % agarose gel electroresis. The specificity of the amplification was confirmed by DNA sequencing. The concentration of the reverse transcribed cDNA in the PCR mixture was adjusted to assure a liner correlation between template and product. The housekeeping gene GAPDH was used as a control template for normalizing relative changes of CXCR2 mRNA in RT-PCR.
Fluorescence-activated cell sorting (FACS) Mononuclear cells were washed three times with cold buffer (PBS-1 % FCS-0.1 % sodium azide), 5×105 cells were resuspended at in 100 µL binding buffer supplemented with 1 µg phycoerythrin-conjugated anti-CXCR2 mAb, or 1 µg phycoerythrin-conjugated isotype anti-IgG1 mAb control, and incubated on ice in the dark for 45 min. Subsequently, the cells were washed twice and analyzed by flow cytometry (Becton Dickson). Only monocytes were accounted according to their light scatter and size during flow cytometry. Mean fluorescence intensity (MFI) was determined by subtracting the MFI of cells stained with AbIgG1 control from MFI of cells stained with AbCXCR2. All flow cytometric analyses were performed on a FACScan flow cytometer using FACScan and Consort 30 software (Becton Dickinson).
Statistical analysis All data represent the mean±SD of at least three independent experiments. Student's t-test was used for the statistical analysis of the results. Values of P<0.05 were considered to be significant.
RESULTS
Effect of ovariectomy and cholesterol-enriched diet on CXCR2 expression in rats Compared with ovary-intact rats, ovariectomy increased CXCR2 mRNA expression by 2.1-fold in rats fed with normal diet. In ovary-intact animals fed with a cholesterol-enriched diet, CXCR2 mRNA expression was increased by 2.3-fold, whereas in the OVX animals fed with a cholesterol-enriched diet, CXCR2 mRNA expression was increased by 4.1-fold (Fig 1). The values for pooled protein expression paralleled those for mRNA expression (Fig 2).
Fig 1. Effect of high-cholesterol diet and ovariectomy on CXCR2 mRNA expression. A) Agarose gel electrophoresis of amplified CXCR2 transcripts. Ovary-intact rats were fed with normal diet for 6 weeks (group 1, control); ovary-intact rats were fed with a high-cholesterol diet for 6 weeks (group 2); OVX rats fed with normal diet for 6 weeks (group 3); or fed with a high-cholesterol diet for 6 weeks (group 4). B) CXCR2 expression was determined by semi-quantitative RT-PCR, normalized to GAPDH. n=4. Mean±SD. bP<0.05 vs control. eP<0.05 vs group 3.
Fig 2. Effect of high-cholesterol diet and ovariectomy on CXCR2 protein expression. A) FACS histograms of rat monocytes stained with control PE-IgG1 or PE-CXCR2. Ovary-intact rats were fed with normal diet for 6 weeks (group 1); ovary-intact rats were fed with a high-cholesterol diet for 6 weeks (group 2); OVX rats fed with normal diet for 6 weeks (group 3); or fed with a high-cholesterol diet for 6 weeks (group 4). B) Mean fluorescence intensity (MFI) of different groups. n=4. Mean±SD. bP<0.05 vs control. eP<0.05 vs group 3.
Effect of estradiol supplementation on basal CXCR2 expression in rats fed with normal diet FACS analysis of pooled samples for CXCR2 protein expression from each of the 4 groups is shown in Fig 3A. MFI of FACS analysis performed on each of the 4 groups is shown in Fig 3B. Compared with ovaryintact rats, ovariectomy increased CXCR2 expression by 130 %. Estradiol 5 and 20 µg·kg-1·d-1 attenuated the increase in CXCR2 protein expression by 25 % and 50 %, respectively, and MFI of the higher dose was similar to that observed in ovary-intact animals.
Fig 3. Effects of ovariectomy and 17
-estradiol
supplementation on CXCR2 protein expression in rats fed with a normal diet for
6 weeks. A) FACS histograms of rat monocytes stained with control PE-IgG1
or PE-CXCR2. Ovary-intact rats fed with normal diet (group 1, control); OVX
rats supplemented with placebo and fed with normal diet (group 2); OVX, injected
with 17
-estradiol 5 µg and
fed with normal diet (group 3); or OVX rats injected with 17
-estradiol
20 µg and fed with normal diet (group 4). B) Mean fluorescence intensity
(MFI) of different groups. n=4. Mean± SD. bP<0.05
vs control. eP<0.05 vs group 2.
Effect of estradiol supplementation on CXCR2 expression in rats fed with a cholesterol-enriched diet FACS analysis of CXCR2 protein expression of pooled samples from the 3 groups is shown in Fig 4A, and the MFI performed on each of the 3 groups is shown in Fig 4B. Estradiol 5 and 20 µg·kg-1·d-1 reduced CXCR2 protein expression by 31 % and 53 %, respectively.
Fig 4. Effect of 17
-estradiol
on CXCR2 protein expression in OVX rats fed with a high-cholesterol diet for
6 weeks. A) FACS histograms of rat monocytes stained with control PE-IgG1
or PE-CXCR2. OVX rats fed with a high-cholesterol diet (group 1, control); OVX
rats injected with 17
-estradiol
5 µg and fed with a high-cholesterol diet (group 2); or injected with 17
-estradiol
20 µg, and fed with a high-cholesterol diet (group 3). B) Mean fluorescence
intensity (MFI) of different groups. n=4. Mean±SD. bP<0.05
vs control. eP<0.05 vs group 2.
DISCUSSION
In previous studies, we have demonstrated that enhanced surface expression of CXCR2 gave rise to an enhanced migration and an improved adhesion of monocytes[12]. Preliminary evidence has shown that estrogen reduces monocyte adherence to vascular endothelium in vivo[3]. However, it is not clear whether the associated reduction in the number of monocytes within the subendothelial space is also due to an estrogen-induced inhibition of the expression of CXCR2.
Other investigators have demonstrated that the chemokine GRO
,
which significantly contributes to monocyte arrest, is expressed
on native atherosclerotic endothelium[14]. We have also shown
that estradiol at physiological levels significantly reduced GRO
expression in human umbilical vein endothelial cells[7]. In the present
study, we demonstrated the effect of estradiol on the chemokine GRO
receptor CXCR2. Consistent with the result of GRO
,
estradiol 5 and 20 µg·kg-1·d-1 attenuated
the increase of CXCR2 protein expression. In animals fed with normal diet, CXCR2
mRNA expression was apparently undetectable, because a visible band
for CXCR2 appeared only after 3 µg of total cellular RNA was
used for 40 cycles of PCR amplification and visualization on 2 %
agarose gel after ethidium bromide staining. These results indicate
that estradiol most likely exerts its regulatory effect on CXCR2
at the level of transcription.
Potential mechanisms by which estradiol may inhibit CXCR2 expression must
be considered. Estradiol acts as an antioxidant in vivo[14],
and in its absence, an increase in lipoprotein oxidation in the artery
wall could account for the increase in CXCR2 expression in the OVX
animals. This scenario is also possible in the animals fed
with normal diet, as rat diet contains significant amounts of linoleic
acid, which makes normal rat LDL especially susceptible to oxidation.
In concurrent studies, 17
-estradiol
reduced expressions of CXCR2 mRNA and protein in endothelial cells incubated
with oxLDL, and the decrease of the CXCR2 protein was dependent on the concentration
of 17
-estradiol.
In summary, our results demonstrate that estradiol at physiological concentrations inhibits CXCR2 expression in vivo. Estrogen causes the associated reduction in the number of monocytes within the subendothelial space due to an estrogen-induced inhibition of the expression of CXCR2. This finding therefore may be one potential mechanism by which estradiol retards atherogenesis.
ACKNOWLEDGMENTS The authors wish to thank Dr PEI Gang, Hu Wei, and ZHANG Wen-Bo for their kind assistance.
REFERENCES
functionally expression
in human endothelial cells. Chin Med J 2001; 114: 1240-4.
expression by estrogen
in human endothelial cells. Acta Pharmacol Sin 2001; 22: 1003-6.